Incidental Mutation 'R0063:Slc2a2'
ID43767
Institutional Source Beutler Lab
Gene Symbol Slc2a2
Ensembl Gene ENSMUSG00000027690
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 2
SynonymsGlut2, liver-type glucose transporter, Glut-2
MMRRC Submission 038355-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0063 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location28697903-28731359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28717440 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 173 (M173T)
Ref Sequence ENSEMBL: ENSMUSP00000029240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029240] [ENSMUST00000163536]
Predicted Effect probably damaging
Transcript: ENSMUST00000029240
AA Change: M173T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029240
Gene: ENSMUSG00000027690
AA Change: M173T

DomainStartEndE-ValueType
Pfam:MFS_1 9 442 4.2e-23 PFAM
Pfam:Sugar_tr 13 498 2.4e-165 PFAM
Pfam:Folate_carrier 187 458 5.3e-12 PFAM
Predicted Effect silent
Transcript: ENSMUST00000163536
SMART Domains Protein: ENSMUSP00000131046
Gene: ENSMUSG00000027690

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 133 3.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169047
Meta Mutation Damage Score 0.4558 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice are hyperglycemic with hypoinsulinemia and die within 2-3 weeks of life displaying increased plasma levels of glucagon, free fatty acids and beta-hydroxybutyrate, abnormal glucose tolerance, and altered postnatal development of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik C T 16: 4,861,048 R245* probably null Het
4930563I02Rik T A 14: 60,096,028 probably benign Het
9330182L06Rik T C 5: 9,440,709 probably benign Het
Acss1 T C 2: 150,627,292 T435A probably damaging Het
Aoc2 T A 11: 101,326,071 S327T probably damaging Het
Arid5a T A 1: 36,318,564 Y252N probably damaging Het
AU040320 T C 4: 126,839,672 Y662H probably damaging Het
B4gat1 T A 19: 5,039,707 L244* probably null Het
Bcam C T 7: 19,766,848 V134I probably benign Het
Btbd16 A T 7: 130,823,166 T426S probably benign Het
Btn1a1 C T 13: 23,465,097 probably null Het
Cap2 T C 13: 46,638,032 probably benign Het
Capn8 T A 1: 182,602,112 D299E probably damaging Het
Cdipt G A 7: 126,979,600 V160I probably benign Het
Cep164 A G 9: 45,768,618 S1267P possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col3a1 T C 1: 45,330,541 probably benign Het
Cyb5r3 T C 15: 83,161,936 T60A probably benign Het
Dgkb T G 12: 38,604,113 S744A probably benign Het
Dock2 T A 11: 34,756,284 probably null Het
Ece1 C T 4: 137,948,581 T422M probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Eml3 C A 19: 8,938,478 A644D probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Foxp1 A G 6: 98,944,723 probably benign Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Il17rd G A 14: 27,082,733 C88Y probably damaging Het
Il17rd C A 14: 27,082,734 C88* probably null Het
Ino80c A G 18: 24,106,624 F160S probably damaging Het
Ints8 T C 4: 11,252,857 N75S probably damaging Het
Irf2bp1 C T 7: 19,005,847 R471C possibly damaging Het
Irs1 T A 1: 82,288,859 E545D probably damaging Het
Lama3 T C 18: 12,528,705 probably benign Het
Mast4 C A 13: 103,334,215 probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Nat8f2 A T 6: 85,867,833 S182R possibly damaging Het
Nrcam G T 12: 44,550,028 V343F possibly damaging Het
Opn5 T C 17: 42,596,626 S120G probably damaging Het
Pdk2 T C 11: 95,032,480 H106R probably benign Het
Pkhd1 G A 1: 20,211,950 T2889I probably benign Het
Pkhd1l1 T A 15: 44,529,237 L1656H probably damaging Het
Plxna2 A T 1: 194,644,939 T394S probably benign Het
Pnpla8 T A 12: 44,282,832 C56S probably damaging Het
Prdm8 G T 5: 98,184,594 R118L probably damaging Het
Prkce T C 17: 86,482,111 probably benign Het
Ptprk T A 10: 28,263,767 Y163N probably damaging Het
Rbbp8 T A 18: 11,734,557 probably benign Het
Rnh1 A T 7: 141,164,196 probably null Het
Rtn4 T A 11: 29,705,527 probably benign Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Slc2a8 T A 2: 32,979,999 probably null Het
Tdpoz1 A T 3: 93,670,814 M221K probably benign Het
Tgm7 G T 2: 121,094,096 H533Q probably benign Het
Timm29 C A 9: 21,593,008 A17E probably benign Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tmem89 A G 9: 108,914,812 N60S probably benign Het
Tpx2 A G 2: 152,880,123 T212A probably damaging Het
Trio G T 15: 27,881,437 probably benign Het
Tulp2 T C 7: 45,520,860 probably benign Het
Uggt2 A G 14: 119,007,130 probably benign Het
Vmn2r5 T A 3: 64,503,800 E449V probably benign Het
Vwa8 A G 14: 79,164,216 probably benign Het
Xirp2 A G 2: 67,509,083 D556G probably damaging Het
Xrn1 T C 9: 95,969,535 L202P probably damaging Het
Zfp354a A T 11: 51,069,571 H203L probably damaging Het
Zfp53 A C 17: 21,508,105 R133S probably benign Het
Zfp787 C T 7: 6,132,323 probably null Het
Other mutations in Slc2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Slc2a2 APN 3 28718741 missense possibly damaging 0.86
IGL01582:Slc2a2 APN 3 28708488 missense probably benign 0.01
IGL01762:Slc2a2 APN 3 28717472 missense probably damaging 1.00
IGL01942:Slc2a2 APN 3 28705803 missense probably damaging 1.00
IGL02128:Slc2a2 APN 3 28719401 missense probably damaging 1.00
IGL02218:Slc2a2 APN 3 28698025 missense possibly damaging 0.94
IGL02278:Slc2a2 APN 3 28717455 missense probably damaging 0.99
IGL02507:Slc2a2 APN 3 28727111 missense probably benign 0.00
IGL02649:Slc2a2 APN 3 28718736 missense probably damaging 0.97
IGL03323:Slc2a2 APN 3 28726290 missense probably damaging 1.00
IGL03147:Slc2a2 UTSW 3 28719370 missense possibly damaging 0.56
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0365:Slc2a2 UTSW 3 28708679 critical splice donor site probably null
R0494:Slc2a2 UTSW 3 28727277 missense probably benign 0.01
R0519:Slc2a2 UTSW 3 28718816 missense possibly damaging 0.54
R1292:Slc2a2 UTSW 3 28717488 missense probably damaging 1.00
R1755:Slc2a2 UTSW 3 28713662 splice site probably null
R1965:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1966:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1982:Slc2a2 UTSW 3 28717441 missense probably benign 0.36
R2937:Slc2a2 UTSW 3 28718771 missense probably damaging 1.00
R3121:Slc2a2 UTSW 3 28721749 missense probably benign 0.01
R3721:Slc2a2 UTSW 3 28727152 missense probably damaging 1.00
R4799:Slc2a2 UTSW 3 28717532 critical splice donor site probably null
R5206:Slc2a2 UTSW 3 28708607 missense probably damaging 1.00
R6829:Slc2a2 UTSW 3 28727441 nonsense probably null
R6864:Slc2a2 UTSW 3 28721725 missense probably damaging 1.00
R6932:Slc2a2 UTSW 3 28717519 missense probably benign 0.40
R7178:Slc2a2 UTSW 3 28719482 missense possibly damaging 0.90
R7599:Slc2a2 UTSW 3 28698017 start codon destroyed probably null 0.02
R7616:Slc2a2 UTSW 3 28727111 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGTTTTCTGCATAAACCATGCCC -3'
(R):5'- AGCAGCTCCAAGTTGGATGTGAGG -3'

Sequencing Primer
(F):5'- CATAAACCATGCCCATGTTTGG -3'
(R):5'- CTCTTATCACTGTAGGAGACGAAGC -3'
Posted On2013-05-29