Incidental Mutation 'R5594:Evi5'
ID437688
Institutional Source Beutler Lab
Gene Symbol Evi5
Ensembl Gene ENSMUSG00000011831
Gene Nameecotropic viral integration site 5
SynonymsNB4S
MMRRC Submission 043146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5594 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107744795-107875107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107820451 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 182 (V182A)
Ref Sequence ENSEMBL: ENSMUSP00000114845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112642] [ENSMUST00000124034] [ENSMUST00000128723] [ENSMUST00000138111] [ENSMUST00000155955]
Predicted Effect probably benign
Transcript: ENSMUST00000112642
AA Change: V226A

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108261
Gene: ENSMUSG00000011831
AA Change: V226A

DomainStartEndE-ValueType
low complexity region 51 80 N/A INTRINSIC
Blast:TBC 81 157 2e-16 BLAST
TBC 160 371 7.92e-91 SMART
internal_repeat_1 450 477 8.83e-6 PROSPERO
internal_repeat_1 494 521 8.83e-6 PROSPERO
coiled coil region 555 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124034
AA Change: V182A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121761
Gene: ENSMUSG00000011831
AA Change: V182A

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 3e-17 BLAST
TBC 116 327 7.92e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127579
Predicted Effect possibly damaging
Transcript: ENSMUST00000128723
AA Change: V182A

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114845
Gene: ENSMUSG00000011831
AA Change: V182A

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 2e-16 BLAST
TBC 116 327 7.92e-91 SMART
internal_repeat_1 466 493 2.66e-6 PROSPERO
internal_repeat_1 510 537 2.66e-6 PROSPERO
coiled coil region 571 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132482
Predicted Effect probably benign
Transcript: ENSMUST00000138111
AA Change: V182A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119196
Gene: ENSMUSG00000011831
AA Change: V182A

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 3e-17 BLAST
TBC 116 327 7.92e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141673
Predicted Effect probably benign
Transcript: ENSMUST00000155955
AA Change: V210A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119758
Gene: ENSMUSG00000011831
AA Change: V210A

DomainStartEndE-ValueType
Blast:TBC 18 133 3e-20 BLAST
Pfam:RabGAP-TBC 150 222 1.6e-11 PFAM
Meta Mutation Damage Score 0.1029 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
4931414P19Rik A G 14: 54,584,984 Y399H probably damaging Het
5430419D17Rik T A 7: 131,239,523 D647E probably benign Het
6430573F11Rik A G 8: 36,512,298 T352A probably benign Het
Abca9 G T 11: 110,144,862 P644Q probably damaging Het
Acly T C 11: 100,522,120 probably null Het
Adamts14 A T 10: 61,227,101 probably null Het
Ankdd1a T C 9: 65,502,241 N471S probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Arhgef28 T C 13: 97,939,492 T1345A probably benign Het
Arhgef40 T A 14: 51,996,157 L820H probably damaging Het
Atp2b4 A G 1: 133,730,510 V554A probably damaging Het
Birc7 G A 2: 180,933,336 probably null Het
Ccdc80 C T 16: 45,116,263 R684C probably benign Het
Cdc25b C A 2: 131,191,618 P159Q probably damaging Het
Chek2 G T 5: 110,855,834 probably null Het
Chil6 C T 3: 106,394,429 probably null Het
Cr2 A G 1: 195,157,190 I643T probably damaging Het
Cwf19l2 C A 9: 3,418,773 Q187K probably benign Het
Cyth4 A G 15: 78,607,075 probably null Het
Depdc5 A G 5: 32,901,490 T268A possibly damaging Het
Dnah17 G T 11: 118,043,229 probably null Het
Dnah3 T C 7: 119,971,621 Y2210C possibly damaging Het
Elmod3 G A 6: 72,594,816 probably benign Het
Eogt T A 6: 97,116,035 T394S probably benign Het
Fbxo30 T C 10: 11,290,479 I315T probably benign Het
Fibcd1 T C 2: 31,838,617 N76S probably damaging Het
Gcc2 G T 10: 58,287,242 R1190M probably damaging Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Glg1 G A 8: 111,187,881 R424C probably damaging Het
Gm11543 T A 11: 94,828,554 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hhip G T 8: 79,996,863 D387E probably damaging Het
Hif1a T A 12: 73,937,792 Y46* probably null Het
Hivep3 G T 4: 120,123,048 probably null Het
Kif13a T A 13: 46,752,862 E535V probably damaging Het
Lrch3 T C 16: 32,914,184 Y15H probably damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Lyst T A 13: 13,759,397 V3560E probably benign Het
Megf11 T C 9: 64,686,473 F613L probably damaging Het
Misp G A 10: 79,827,143 V465M probably damaging Het
Ms4a6c T A 19: 11,478,173 D115E probably benign Het
Msh6 A G 17: 87,986,069 T751A probably benign Het
Ntrk3 T A 7: 78,451,899 T429S probably benign Het
Olfr128 T A 17: 37,923,611 M15K probably benign Het
Olfr857 T C 9: 19,713,006 Y60H probably damaging Het
Oplah A C 15: 76,296,637 *1289G probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhga6 A T 18: 37,708,528 T434S probably benign Het
Pign A G 1: 105,646,869 probably benign Het
Poteg A T 8: 27,447,968 I51F probably benign Het
Prrc2c C A 1: 162,699,031 V204F unknown Het
Rhbdd3 T C 11: 5,105,710 S325P probably damaging Het
Rit1 T A 3: 88,729,137 L116Q probably damaging Het
Rpl22 T A 4: 152,325,802 probably benign Het
Rttn A G 18: 89,090,436 E1588G possibly damaging Het
Sardh A G 2: 27,220,723 F577S probably damaging Het
Slc12a7 T A 13: 73,785,139 D105E probably benign Het
Slc22a23 T A 13: 34,305,257 D215V probably damaging Het
Slc4a8 C A 15: 100,795,887 P438T probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Stk19 C T 17: 34,820,562 probably benign Het
Stx5a T C 19: 8,748,465 I143T probably damaging Het
Tep1 T C 14: 50,829,882 H2232R possibly damaging Het
Ttc21b A G 2: 66,236,235 I358T probably benign Het
Tuba8 A G 6: 121,225,904 D392G possibly damaging Het
Vmn1r1 G A 1: 182,157,407 P231L probably damaging Het
Zfp330 A G 8: 82,767,312 W107R probably damaging Het
Zfp715 T A 7: 43,299,692 Q281H possibly damaging Het
Zfp9 T C 6: 118,465,039 T221A probably damaging Het
Zgpat T C 2: 181,365,627 probably benign Het
Other mutations in Evi5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Evi5 APN 5 107815611 missense probably benign 0.05
IGL01458:Evi5 APN 5 107815647 missense probably damaging 1.00
IGL01615:Evi5 APN 5 107764707 missense probably damaging 1.00
IGL01939:Evi5 APN 5 107816924 unclassified probably benign
IGL02170:Evi5 APN 5 107821884 missense probably benign 0.45
IGL02539:Evi5 APN 5 107815665 missense probably benign 0.09
IGL02655:Evi5 APN 5 107813580 missense probably benign 0.36
IGL03040:Evi5 APN 5 107821806 missense probably damaging 1.00
IGL03058:Evi5 APN 5 107748151 missense probably damaging 0.98
R0125:Evi5 UTSW 5 107795772 missense probably benign 0.06
R0172:Evi5 UTSW 5 107790462 missense probably benign
R0334:Evi5 UTSW 5 107820535 missense probably damaging 0.97
R0335:Evi5 UTSW 5 107812411 missense probably benign 0.06
R0526:Evi5 UTSW 5 107821748 missense probably benign 0.44
R0579:Evi5 UTSW 5 107821709 missense probably benign 0.36
R0585:Evi5 UTSW 5 107813536 unclassified probably benign
R1123:Evi5 UTSW 5 107820578 missense probably benign 0.02
R1618:Evi5 UTSW 5 107799118 splice site probably benign
R1699:Evi5 UTSW 5 107818920 missense probably damaging 1.00
R1772:Evi5 UTSW 5 107795841 missense probably benign 0.32
R1969:Evi5 UTSW 5 107748364 missense probably benign 0.04
R1977:Evi5 UTSW 5 107799139 nonsense probably null
R2010:Evi5 UTSW 5 107813545 critical splice donor site probably null
R3736:Evi5 UTSW 5 107818983 missense probably damaging 0.98
R5047:Evi5 UTSW 5 107821874 missense probably damaging 1.00
R5252:Evi5 UTSW 5 107795752 missense probably benign
R5350:Evi5 UTSW 5 107815678 missense probably benign 0.08
R5552:Evi5 UTSW 5 107818989 missense probably damaging 1.00
R5895:Evi5 UTSW 5 107820436 missense probably damaging 1.00
R6334:Evi5 UTSW 5 107820521 nonsense probably null
R6364:Evi5 UTSW 5 107842113 missense probably damaging 1.00
R6838:Evi5 UTSW 5 107842161 missense possibly damaging 0.94
R6861:Evi5 UTSW 5 107748318 missense probably benign 0.00
R7032:Evi5 UTSW 5 107788281 missense probably benign 0.14
R7386:Evi5 UTSW 5 107809823 splice site probably null
R7844:Evi5 UTSW 5 107874994 missense probably benign 0.00
R8248:Evi5 UTSW 5 107818887 critical splice donor site probably null
R8298:Evi5 UTSW 5 107816865 missense possibly damaging 0.53
X0018:Evi5 UTSW 5 107818887 critical splice donor site probably null
X0027:Evi5 UTSW 5 107764762 missense probably damaging 0.98
Z1177:Evi5 UTSW 5 107748379 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAAACTACATGTTGATGAAGCGTC -3'
(R):5'- AGGAGCTTGTTCGTAAAGGG -3'

Sequencing Primer
(F):5'- TGTTGATGAAGCGTCAGAATTAAAGC -3'
(R):5'- CCATCACTTCAGAGCAATAGTGTGG -3'
Posted On2016-10-26