Incidental Mutation 'R5594:Elmod3'
ID437690
Institutional Source Beutler Lab
Gene Symbol Elmod3
Ensembl Gene ENSMUSG00000056698
Gene NameELMO/CED-12 domain containing 3
SynonymsELMOD3, RBM29, Rbed1, C330008I15Rik
MMRRC Submission 043146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5594 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location72565922-72598413 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 72594816 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070597] [ENSMUST00000070990] [ENSMUST00000114069] [ENSMUST00000141833] [ENSMUST00000148108] [ENSMUST00000152705] [ENSMUST00000176168] [ENSMUST00000176364]
Predicted Effect probably benign
Transcript: ENSMUST00000070597
SMART Domains Protein: ENSMUSP00000068568
Gene: ENSMUSG00000056666

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:FAD_binding_2 68 113 8.9e-9 PFAM
Pfam:NAD_binding_8 71 136 1.3e-15 PFAM
Pfam:Amino_oxidase 76 587 2.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070990
SMART Domains Protein: ENSMUSP00000067768
Gene: ENSMUSG00000056698

DomainStartEndE-ValueType
Pfam:ELMO_CED12 151 314 3.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114069
SMART Domains Protein: ENSMUSP00000109703
Gene: ENSMUSG00000056698

DomainStartEndE-ValueType
Pfam:ELMO_CED12 154 313 1.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140825
Predicted Effect probably benign
Transcript: ENSMUST00000141833
Predicted Effect probably benign
Transcript: ENSMUST00000148108
Predicted Effect probably benign
Transcript: ENSMUST00000152705
Predicted Effect probably benign
Transcript: ENSMUST00000176168
SMART Domains Protein: ENSMUSP00000135421
Gene: ENSMUSG00000056666

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1gpea1 95 175 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176364
SMART Domains Protein: ENSMUSP00000134847
Gene: ENSMUSG00000056666

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1d5ta1 91 290 7e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility family of GTPase-activating proteins that regulate Arf GTPase proteins. Members of this family are defined by a conserved engulfment and cell motility domain. In rat cochlea, the encoded protein is found in stereocilia, kinocilia and cuticular plate of developing hair cells suggesting a function for this protein in cochlear sensory cells. An allelic variant of this family has been associated with autosomal recessive nonsyndromic deafness-88 in humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
4931414P19Rik A G 14: 54,584,984 Y399H probably damaging Het
5430419D17Rik T A 7: 131,239,523 D647E probably benign Het
6430573F11Rik A G 8: 36,512,298 T352A probably benign Het
Abca9 G T 11: 110,144,862 P644Q probably damaging Het
Acly T C 11: 100,522,120 probably null Het
Adamts14 A T 10: 61,227,101 probably null Het
Ankdd1a T C 9: 65,502,241 N471S probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Arhgef28 T C 13: 97,939,492 T1345A probably benign Het
Arhgef40 T A 14: 51,996,157 L820H probably damaging Het
Atp2b4 A G 1: 133,730,510 V554A probably damaging Het
Birc7 G A 2: 180,933,336 probably null Het
Ccdc80 C T 16: 45,116,263 R684C probably benign Het
Cdc25b C A 2: 131,191,618 P159Q probably damaging Het
Chek2 G T 5: 110,855,834 probably null Het
Chil6 C T 3: 106,394,429 probably null Het
Cr2 A G 1: 195,157,190 I643T probably damaging Het
Cwf19l2 C A 9: 3,418,773 Q187K probably benign Het
Cyth4 A G 15: 78,607,075 probably null Het
Depdc5 A G 5: 32,901,490 T268A possibly damaging Het
Dnah17 G T 11: 118,043,229 probably null Het
Dnah3 T C 7: 119,971,621 Y2210C possibly damaging Het
Eogt T A 6: 97,116,035 T394S probably benign Het
Evi5 A G 5: 107,820,451 V182A possibly damaging Het
Fbxo30 T C 10: 11,290,479 I315T probably benign Het
Fibcd1 T C 2: 31,838,617 N76S probably damaging Het
Gcc2 G T 10: 58,287,242 R1190M probably damaging Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Glg1 G A 8: 111,187,881 R424C probably damaging Het
Gm11543 T A 11: 94,828,554 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hhip G T 8: 79,996,863 D387E probably damaging Het
Hif1a T A 12: 73,937,792 Y46* probably null Het
Hivep3 G T 4: 120,123,048 probably null Het
Kif13a T A 13: 46,752,862 E535V probably damaging Het
Lrch3 T C 16: 32,914,184 Y15H probably damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Lyst T A 13: 13,759,397 V3560E probably benign Het
Megf11 T C 9: 64,686,473 F613L probably damaging Het
Misp G A 10: 79,827,143 V465M probably damaging Het
Ms4a6c T A 19: 11,478,173 D115E probably benign Het
Msh6 A G 17: 87,986,069 T751A probably benign Het
Ntrk3 T A 7: 78,451,899 T429S probably benign Het
Olfr128 T A 17: 37,923,611 M15K probably benign Het
Olfr857 T C 9: 19,713,006 Y60H probably damaging Het
Oplah A C 15: 76,296,637 *1289G probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhga6 A T 18: 37,708,528 T434S probably benign Het
Pign A G 1: 105,646,869 probably benign Het
Poteg A T 8: 27,447,968 I51F probably benign Het
Prrc2c C A 1: 162,699,031 V204F unknown Het
Rhbdd3 T C 11: 5,105,710 S325P probably damaging Het
Rit1 T A 3: 88,729,137 L116Q probably damaging Het
Rpl22 T A 4: 152,325,802 probably benign Het
Rttn A G 18: 89,090,436 E1588G possibly damaging Het
Sardh A G 2: 27,220,723 F577S probably damaging Het
Slc12a7 T A 13: 73,785,139 D105E probably benign Het
Slc22a23 T A 13: 34,305,257 D215V probably damaging Het
Slc4a8 C A 15: 100,795,887 P438T probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Stk19 C T 17: 34,820,562 probably benign Het
Stx5a T C 19: 8,748,465 I143T probably damaging Het
Tep1 T C 14: 50,829,882 H2232R possibly damaging Het
Ttc21b A G 2: 66,236,235 I358T probably benign Het
Tuba8 A G 6: 121,225,904 D392G possibly damaging Het
Vmn1r1 G A 1: 182,157,407 P231L probably damaging Het
Zfp330 A G 8: 82,767,312 W107R probably damaging Het
Zfp715 T A 7: 43,299,692 Q281H possibly damaging Het
Zfp9 T C 6: 118,465,039 T221A probably damaging Het
Zgpat T C 2: 181,365,627 probably benign Het
Other mutations in Elmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Elmod3 APN 6 72586507 missense possibly damaging 0.66
IGL02725:Elmod3 APN 6 72594775 missense probably damaging 0.96
IGL03089:Elmod3 APN 6 72569316 missense probably damaging 1.00
R0092:Elmod3 UTSW 6 72566809 missense probably benign
R0173:Elmod3 UTSW 6 72577588 missense probably damaging 1.00
R0925:Elmod3 UTSW 6 72568938 missense probably damaging 1.00
R1602:Elmod3 UTSW 6 72569259 critical splice donor site probably null
R3147:Elmod3 UTSW 6 72586502 missense probably benign 0.01
R5870:Elmod3 UTSW 6 72594738 critical splice donor site probably null
R6045:Elmod3 UTSW 6 72568868 missense probably benign
R7173:Elmod3 UTSW 6 72577252 critical splice donor site probably null
R7229:Elmod3 UTSW 6 72594753 missense probably benign 0.09
Z1177:Elmod3 UTSW 6 72566689 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CGGTTGACTGCTGAACTACAC -3'
(R):5'- TCCTTTCAGGACTCATAGAAACC -3'

Sequencing Primer
(F):5'- GTTGACTGCTGAACTACACCTTCAG -3'
(R):5'- ATAGAAACCTCCTGCACCTTGGTG -3'
Posted On2016-10-26