Incidental Mutation 'R0063:Ece1'
ID43772
Institutional Source Beutler Lab
Gene Symbol Ece1
Ensembl Gene ENSMUSG00000057530
Gene Nameendothelin converting enzyme 1
Synonyms
MMRRC Submission 038355-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R0063 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137862237-137965229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137948581 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 422 (T422M)
Ref Sequence ENSEMBL: ENSMUSP00000099576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102518]
Predicted Effect probably benign
Transcript: ENSMUST00000102518
AA Change: T422M

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530
AA Change: T422M

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Peptidase_M13_N 105 490 1.2e-112 PFAM
Pfam:Peptidase_M13 549 752 1.8e-77 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik C T 16: 4,861,048 R245* probably null Het
4930563I02Rik T A 14: 60,096,028 probably benign Het
9330182L06Rik T C 5: 9,440,709 probably benign Het
Acss1 T C 2: 150,627,292 T435A probably damaging Het
Aoc2 T A 11: 101,326,071 S327T probably damaging Het
Arid5a T A 1: 36,318,564 Y252N probably damaging Het
AU040320 T C 4: 126,839,672 Y662H probably damaging Het
B4gat1 T A 19: 5,039,707 L244* probably null Het
Bcam C T 7: 19,766,848 V134I probably benign Het
Btbd16 A T 7: 130,823,166 T426S probably benign Het
Btn1a1 C T 13: 23,465,097 probably null Het
Cap2 T C 13: 46,638,032 probably benign Het
Capn8 T A 1: 182,602,112 D299E probably damaging Het
Cdipt G A 7: 126,979,600 V160I probably benign Het
Cep164 A G 9: 45,768,618 S1267P possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col3a1 T C 1: 45,330,541 probably benign Het
Cyb5r3 T C 15: 83,161,936 T60A probably benign Het
Dgkb T G 12: 38,604,113 S744A probably benign Het
Dock2 T A 11: 34,756,284 probably null Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Eml3 C A 19: 8,938,478 A644D probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Foxp1 A G 6: 98,944,723 probably benign Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Il17rd G A 14: 27,082,733 C88Y probably damaging Het
Il17rd C A 14: 27,082,734 C88* probably null Het
Ino80c A G 18: 24,106,624 F160S probably damaging Het
Ints8 T C 4: 11,252,857 N75S probably damaging Het
Irf2bp1 C T 7: 19,005,847 R471C possibly damaging Het
Irs1 T A 1: 82,288,859 E545D probably damaging Het
Lama3 T C 18: 12,528,705 probably benign Het
Mast4 C A 13: 103,334,215 probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Nat8f2 A T 6: 85,867,833 S182R possibly damaging Het
Nrcam G T 12: 44,550,028 V343F possibly damaging Het
Opn5 T C 17: 42,596,626 S120G probably damaging Het
Pdk2 T C 11: 95,032,480 H106R probably benign Het
Pkhd1 G A 1: 20,211,950 T2889I probably benign Het
Pkhd1l1 T A 15: 44,529,237 L1656H probably damaging Het
Plxna2 A T 1: 194,644,939 T394S probably benign Het
Pnpla8 T A 12: 44,282,832 C56S probably damaging Het
Prdm8 G T 5: 98,184,594 R118L probably damaging Het
Prkce T C 17: 86,482,111 probably benign Het
Ptprk T A 10: 28,263,767 Y163N probably damaging Het
Rbbp8 T A 18: 11,734,557 probably benign Het
Rnh1 A T 7: 141,164,196 probably null Het
Rtn4 T A 11: 29,705,527 probably benign Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Slc2a2 T C 3: 28,717,440 M173T probably damaging Het
Slc2a8 T A 2: 32,979,999 probably null Het
Tdpoz1 A T 3: 93,670,814 M221K probably benign Het
Tgm7 G T 2: 121,094,096 H533Q probably benign Het
Timm29 C A 9: 21,593,008 A17E probably benign Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tmem89 A G 9: 108,914,812 N60S probably benign Het
Tpx2 A G 2: 152,880,123 T212A probably damaging Het
Trio G T 15: 27,881,437 probably benign Het
Tulp2 T C 7: 45,520,860 probably benign Het
Uggt2 A G 14: 119,007,130 probably benign Het
Vmn2r5 T A 3: 64,503,800 E449V probably benign Het
Vwa8 A G 14: 79,164,216 probably benign Het
Xirp2 A G 2: 67,509,083 D556G probably damaging Het
Xrn1 T C 9: 95,969,535 L202P probably damaging Het
Zfp354a A T 11: 51,069,571 H203L probably damaging Het
Zfp53 A C 17: 21,508,105 R133S probably benign Het
Zfp787 C T 7: 6,132,323 probably null Het
Other mutations in Ece1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Ece1 APN 4 137938658 missense probably damaging 1.00
IGL01538:Ece1 APN 4 137948544 missense probably benign
IGL01588:Ece1 APN 4 137957206 splice site probably benign
IGL01678:Ece1 APN 4 137962733 missense probably damaging 1.00
IGL02619:Ece1 APN 4 137938733 missense probably benign 0.08
IGL02936:Ece1 APN 4 137946301 missense probably benign 0.01
IGL02956:Ece1 APN 4 137962838 missense probably damaging 0.99
IGL03332:Ece1 APN 4 137946355 missense probably damaging 0.99
R0240:Ece1 UTSW 4 137949435 splice site probably benign
R1004:Ece1 UTSW 4 137926239 missense probably benign 0.04
R1515:Ece1 UTSW 4 137951508 missense probably benign 0.00
R1541:Ece1 UTSW 4 137948660 splice site probably null
R1796:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958128 missense probably damaging 0.99
R1836:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1930:Ece1 UTSW 4 137938763 missense probably benign 0.01
R1931:Ece1 UTSW 4 137938763 missense probably benign 0.01
R2065:Ece1 UTSW 4 137958082 missense probably benign 0.04
R2281:Ece1 UTSW 4 137946362 missense possibly damaging 0.93
R3118:Ece1 UTSW 4 137948544 missense probably benign
R4720:Ece1 UTSW 4 137957175 missense probably damaging 1.00
R4773:Ece1 UTSW 4 137945153 missense probably benign 0.00
R5794:Ece1 UTSW 4 137956533 missense probably damaging 0.99
R5969:Ece1 UTSW 4 137961740 critical splice donor site probably null
R6056:Ece1 UTSW 4 137961647 missense probably damaging 1.00
R6332:Ece1 UTSW 4 137958008 missense probably damaging 1.00
R6648:Ece1 UTSW 4 137921159 missense probably benign 0.00
R7285:Ece1 UTSW 4 137913763 splice site probably null
R7387:Ece1 UTSW 4 137938784 missense possibly damaging 0.69
R8103:Ece1 UTSW 4 137913822 missense probably benign
R8294:Ece1 UTSW 4 137948620 missense possibly damaging 0.60
R8308:Ece1 UTSW 4 137936764 missense probably damaging 0.99
R8806:Ece1 UTSW 4 137945141 missense probably damaging 1.00
X0063:Ece1 UTSW 4 137926375 missense probably damaging 0.97
Z1176:Ece1 UTSW 4 137921027 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TCAGAAAACGTATCTCTGAAGCGCC -3'
(R):5'- CGATGAACAGTAGCAGCTCTGGAAG -3'

Sequencing Primer
(F):5'- CAGGAGAAAGCACAGGCCC -3'
(R):5'- CAGCTCTGGAAGGTAACTATGTC -3'
Posted On2013-05-29