Mutagenetix > Incidental Mutation

Incidental Mutation 'R5594:Slc22a23'

437722

Institutional Source

Beutler Lab

Gene Symbol

Slc22a23

Ensembl Gene

ENSMUSG00000038267

Gene Name

solute carrier family 22, member 23

Synonyms

3110004L20Rik

MMRRC Submission

043146-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R5594 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34179158-34345182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34305257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 215 (D215V)

Ref Sequence

ENSEMBL: ENSMUSP00000042742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040336]

AlphaFold

Q3UHH2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040336
AA Change: D215V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: D215V

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	153	164	N/A	INTRINSIC
Pfam:Sugar_tr	187	633	5e-26	PFAM
Pfam:MFS_1	224	518	2.6e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143353

Predicted Effect

probably benign
Transcript: ENSMUST00000145038

SMART Domains

Protein: ENSMUSP00000122376
Gene: ENSMUSG00000038267

Domain	Start	End	E-Value	Type
low complexity region	86	97	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000148390
AA Change: D99V

SMART Domains

Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: D99V

Domain	Start	End	E-Value	Type
low complexity region	38	49	N/A	INTRINSIC
Pfam:Sugar_tr	71	510	1.4e-27	PFAM
Pfam:MFS_1	109	402	1.5e-12	PFAM

Meta Mutation Damage Score

0.3351

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.4%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930556J24Rik	C	T	11: 3,938,027	V120I	unknown	Het
4931414P19Rik	A	G	14: 54,584,984	Y399H	probably damaging	Het
5430419D17Rik	T	A	7: 131,239,523	D647E	probably benign	Het
6430573F11Rik	A	G	8: 36,512,298	T352A	probably benign	Het
Abca9	G	T	11: 110,144,862	P644Q	probably damaging	Het
Acly	T	C	11: 100,522,120		probably null	Het
Adamts14	A	T	10: 61,227,101		probably null	Het
Ankdd1a	T	C	9: 65,502,241	N471S	probably damaging	Het
Ankrd39	C	T	1: 36,541,981	G96R	probably damaging	Het
Arhgef28	T	C	13: 97,939,492	T1345A	probably benign	Het
Arhgef40	T	A	14: 51,996,157	L820H	probably damaging	Het
Atp2b4	A	G	1: 133,730,510	V554A	probably damaging	Het
Birc7	G	A	2: 180,933,336		probably null	Het
Ccdc80	C	T	16: 45,116,263	R684C	probably benign	Het
Cdc25b	C	A	2: 131,191,618	P159Q	probably damaging	Het
Chek2	G	T	5: 110,855,834		probably null	Het
Chil6	C	T	3: 106,394,429		probably null	Het
Cr2	A	G	1: 195,157,190	I643T	probably damaging	Het
Cwf19l2	C	A	9: 3,418,773	Q187K	probably benign	Het
Cyth4	A	G	15: 78,607,075		probably null	Het
Depdc5	A	G	5: 32,901,490	T268A	possibly damaging	Het
Dnah17	G	T	11: 118,043,229		probably null	Het
Dnah3	T	C	7: 119,971,621	Y2210C	possibly damaging	Het
Elmod3	G	A	6: 72,594,816		probably benign	Het
Eogt	T	A	6: 97,116,035	T394S	probably benign	Het
Evi5	A	G	5: 107,820,451	V182A	possibly damaging	Het
Fbxo30	T	C	10: 11,290,479	I315T	probably benign	Het
Fibcd1	T	C	2: 31,838,617	N76S	probably damaging	Het
Gcc2	G	T	10: 58,287,242	R1190M	probably damaging	Het
Gfm2	T	C	13: 97,165,038	S450P	probably damaging	Het
Glg1	G	A	8: 111,187,881	R424C	probably damaging	Het
Gm11543	T	A	11: 94,828,554		noncoding transcript	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Hhip	G	T	8: 79,996,863	D387E	probably damaging	Het
Hif1a	T	A	12: 73,937,792	Y46*	probably null	Het
Hivep3	G	T	4: 120,123,048		probably null	Het
Kif13a	T	A	13: 46,752,862	E535V	probably damaging	Het
Lrch3	T	C	16: 32,914,184	Y15H	probably damaging	Het
Lyst	T	G	13: 13,743,333	I3326S	probably damaging	Het
Lyst	T	A	13: 13,759,397	V3560E	probably benign	Het
Megf11	T	C	9: 64,686,473	F613L	probably damaging	Het
Misp	G	A	10: 79,827,143	V465M	probably damaging	Het
Ms4a6c	T	A	19: 11,478,173	D115E	probably benign	Het
Msh6	A	G	17: 87,986,069	T751A	probably benign	Het
Ntrk3	T	A	7: 78,451,899	T429S	probably benign	Het
Olfr128	T	A	17: 37,923,611	M15K	probably benign	Het
Olfr857	T	C	9: 19,713,006	Y60H	probably damaging	Het
Oplah	A	C	15: 76,296,637	*1289G	probably null	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdhga6	A	T	18: 37,708,528	T434S	probably benign	Het
Pign	A	G	1: 105,646,869		probably benign	Het
Poteg	A	T	8: 27,447,968	I51F	probably benign	Het
Prrc2c	C	A	1: 162,699,031	V204F	unknown	Het
Rhbdd3	T	C	11: 5,105,710	S325P	probably damaging	Het
Rit1	T	A	3: 88,729,137	L116Q	probably damaging	Het
Rpl22	T	A	4: 152,325,802		probably benign	Het
Rttn	A	G	18: 89,090,436	E1588G	possibly damaging	Het
Sardh	A	G	2: 27,220,723	F577S	probably damaging	Het
Slc12a7	T	A	13: 73,785,139	D105E	probably benign	Het
Slc4a8	C	A	15: 100,795,887	P438T	probably damaging	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Stk19	C	T	17: 34,820,562		probably benign	Het
Stx5a	T	C	19: 8,748,465	I143T	probably damaging	Het
Tep1	T	C	14: 50,829,882	H2232R	possibly damaging	Het
Ttc21b	A	G	2: 66,236,235	I358T	probably benign	Het
Tuba8	A	G	6: 121,225,904	D392G	possibly damaging	Het
Vmn1r1	G	A	1: 182,157,407	P231L	probably damaging	Het
Zfp330	A	G	8: 82,767,312	W107R	probably damaging	Het
Zfp715	T	A	7: 43,299,692	Q281H	possibly damaging	Het
Zfp9	T	C	6: 118,465,039	T221A	probably damaging	Het
Zgpat	T	C	2: 181,365,627		probably benign	Het

Other mutations in Slc22a23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Slc22a23	APN	13	34305245	missense	probably damaging	1.00
IGL01762:Slc22a23	APN	13	34204001	missense	possibly damaging	0.71
IGL02496:Slc22a23	APN	13	34344485	missense	possibly damaging	0.93
IGL02516:Slc22a23	APN	13	34203955	missense	probably benign	0.02
IGL02831:Slc22a23	APN	13	34299069	missense	possibly damaging	0.81
Foreshadowed	UTSW	13	34195479	missense	probably damaging	0.98
foretold	UTSW	13	34305180	missense	probably benign	0.08
BB009:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
BB019:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
R0234:Slc22a23	UTSW	13	34183261	missense	probably damaging	1.00
R0234:Slc22a23	UTSW	13	34183261	missense	probably damaging	1.00
R0413:Slc22a23	UTSW	13	34183132	missense	probably damaging	1.00
R0557:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0558:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0636:Slc22a23	UTSW	13	34299093	missense	probably benign	0.01
R0676:Slc22a23	UTSW	13	34195479	missense	probably damaging	0.98
R0739:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0990:Slc22a23	UTSW	13	34195467	missense	probably damaging	1.00
R1515:Slc22a23	UTSW	13	34203964	missense	probably benign	0.33
R2128:Slc22a23	UTSW	13	34203970	missense	possibly damaging	0.76
R2147:Slc22a23	UTSW	13	34183007	missense	probably benign	0.00
R3113:Slc22a23	UTSW	13	34183075	missense	probably damaging	0.98
R3780:Slc22a23	UTSW	13	34344340	missense	probably benign	0.14
R3945:Slc22a23	UTSW	13	34183126	missense	probably damaging	0.98
R3946:Slc22a23	UTSW	13	34183126	missense	probably damaging	0.98
R4056:Slc22a23	UTSW	13	34299004	nonsense	probably null
R4095:Slc22a23	UTSW	13	34305206	missense	probably damaging	1.00
R4854:Slc22a23	UTSW	13	34203941	missense	probably benign
R5611:Slc22a23	UTSW	13	34305239	missense	probably benign	0.00
R6167:Slc22a23	UTSW	13	34344559	missense	probably damaging	0.97
R6927:Slc22a23	UTSW	13	34344379	missense	probably benign	0.07
R6933:Slc22a23	UTSW	13	34305180	missense	probably benign	0.08
R6960:Slc22a23	UTSW	13	34344157	critical splice donor site	probably null
R7291:Slc22a23	UTSW	13	34197839	missense	probably damaging	0.99
R7313:Slc22a23	UTSW	13	34183178	missense	probably damaging	1.00
R7932:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
R8058:Slc22a23	UTSW	13	34305184	nonsense	probably null
R9385:Slc22a23	UTSW	13	34344578	missense	probably benign	0.05
R9560:Slc22a23	UTSW	13	34197868	missense	possibly damaging	0.51
R9630:Slc22a23	UTSW	13	34195407	missense	possibly damaging	0.93
X0064:Slc22a23	UTSW	13	34344466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTCTCTTCTGGCATCAG -3'
(R):5'- TTGGATTTTCAGCAGCCCAC -3'

Sequencing Primer
(F):5'- AGTGACCCGGAGCTAACC -3'
(R):5'- AGCAGCCCACGATGATATTCTTC -3'

Posted On

2016-10-26