Incidental Mutation 'R5594:Slc22a23'
ID 437722
Institutional Source Beutler Lab
Gene Symbol Slc22a23
Ensembl Gene ENSMUSG00000038267
Gene Name solute carrier family 22, member 23
Synonyms 3110004L20Rik
MMRRC Submission 043146-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R5594 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 34363141-34529165 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34489240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 215 (D215V)
Ref Sequence ENSEMBL: ENSMUSP00000042742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040336]
AlphaFold Q3UHH2
Predicted Effect probably damaging
Transcript: ENSMUST00000040336
AA Change: D215V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: D215V

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
Pfam:Sugar_tr 187 633 5e-26 PFAM
Pfam:MFS_1 224 518 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143353
Predicted Effect probably benign
Transcript: ENSMUST00000145038
SMART Domains Protein: ENSMUSP00000122376
Gene: ENSMUSG00000038267

DomainStartEndE-ValueType
low complexity region 86 97 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148390
AA Change: D99V
SMART Domains Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: D99V

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
Pfam:Sugar_tr 71 510 1.4e-27 PFAM
Pfam:MFS_1 109 402 1.5e-12 PFAM
Meta Mutation Damage Score 0.3351 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,888,027 (GRCm39) V120I unknown Het
4931414P19Rik A G 14: 54,822,441 (GRCm39) Y399H probably damaging Het
Abca9 G T 11: 110,035,688 (GRCm39) P644Q probably damaging Het
Acly T C 11: 100,412,946 (GRCm39) probably null Het
Adamts14 A T 10: 61,062,880 (GRCm39) probably null Het
Ankdd1a T C 9: 65,409,523 (GRCm39) N471S probably damaging Het
Ankrd39 C T 1: 36,581,062 (GRCm39) G96R probably damaging Het
Arhgef28 T C 13: 98,076,000 (GRCm39) T1345A probably benign Het
Arhgef40 T A 14: 52,233,614 (GRCm39) L820H probably damaging Het
Atp2b4 A G 1: 133,658,248 (GRCm39) V554A probably damaging Het
Birc7 G A 2: 180,575,129 (GRCm39) probably null Het
Ccdc80 C T 16: 44,936,626 (GRCm39) R684C probably benign Het
Cdc25b C A 2: 131,033,538 (GRCm39) P159Q probably damaging Het
Cdcp3 T A 7: 130,841,252 (GRCm39) D647E probably benign Het
Chek2 G T 5: 111,003,700 (GRCm39) probably null Het
Chil6 C T 3: 106,301,745 (GRCm39) probably null Het
Cr2 A G 1: 194,839,498 (GRCm39) I643T probably damaging Het
Cwf19l2 C A 9: 3,418,773 (GRCm39) Q187K probably benign Het
Cyth4 A G 15: 78,491,275 (GRCm39) probably null Het
Depdc5 A G 5: 33,058,834 (GRCm39) T268A possibly damaging Het
Dnah17 G T 11: 117,934,055 (GRCm39) probably null Het
Dnah3 T C 7: 119,570,844 (GRCm39) Y2210C possibly damaging Het
Elmod3 G A 6: 72,571,799 (GRCm39) probably benign Het
Eogt T A 6: 97,092,996 (GRCm39) T394S probably benign Het
Evi5 A G 5: 107,968,317 (GRCm39) V182A possibly damaging Het
Fbxo30 T C 10: 11,166,223 (GRCm39) I315T probably benign Het
Fibcd1 T C 2: 31,728,629 (GRCm39) N76S probably damaging Het
Gcc2 G T 10: 58,123,064 (GRCm39) R1190M probably damaging Het
Gfm2 T C 13: 97,301,546 (GRCm39) S450P probably damaging Het
Glg1 G A 8: 111,914,513 (GRCm39) R424C probably damaging Het
Gm11543 T A 11: 94,719,380 (GRCm39) noncoding transcript Het
Hhip G T 8: 80,723,492 (GRCm39) D387E probably damaging Het
Hif1a T A 12: 73,984,566 (GRCm39) Y46* probably null Het
Hivep3 G T 4: 119,980,245 (GRCm39) probably null Het
Kif13a T A 13: 46,906,338 (GRCm39) E535V probably damaging Het
Lrch3 T C 16: 32,734,554 (GRCm39) Y15H probably damaging Het
Lyst T G 13: 13,917,918 (GRCm39) I3326S probably damaging Het
Lyst T A 13: 13,933,982 (GRCm39) V3560E probably benign Het
Megf11 T C 9: 64,593,755 (GRCm39) F613L probably damaging Het
Misp G A 10: 79,662,977 (GRCm39) V465M probably damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Ms4a6c T A 19: 11,455,537 (GRCm39) D115E probably benign Het
Msh6 A G 17: 88,293,497 (GRCm39) T751A probably benign Het
Ntrk3 T A 7: 78,101,647 (GRCm39) T429S probably benign Het
Oplah A C 15: 76,180,837 (GRCm39) *1289G probably null Het
Or14j7 T A 17: 38,234,502 (GRCm39) M15K probably benign Het
Or7e166 T C 9: 19,624,302 (GRCm39) Y60H probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pcdhga6 A T 18: 37,841,581 (GRCm39) T434S probably benign Het
Pign A G 1: 105,574,594 (GRCm39) probably benign Het
Poteg A T 8: 27,937,996 (GRCm39) I51F probably benign Het
Prrc2c C A 1: 162,526,600 (GRCm39) V204F unknown Het
Rhbdd3 T C 11: 5,055,710 (GRCm39) S325P probably damaging Het
Rit1 T A 3: 88,636,444 (GRCm39) L116Q probably damaging Het
Rpl22 T A 4: 152,410,259 (GRCm39) probably benign Het
Rttn A G 18: 89,108,560 (GRCm39) E1588G possibly damaging Het
Sardh A G 2: 27,110,735 (GRCm39) F577S probably damaging Het
Slc12a7 T A 13: 73,933,258 (GRCm39) D105E probably benign Het
Slc4a8 C A 15: 100,693,768 (GRCm39) P438T probably damaging Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Stk19 C T 17: 35,039,538 (GRCm39) probably benign Het
Stx5a T C 19: 8,725,829 (GRCm39) I143T probably damaging Het
Tep1 T C 14: 51,067,339 (GRCm39) H2232R possibly damaging Het
Trmt9b A G 8: 36,979,452 (GRCm39) T352A probably benign Het
Ttc21b A G 2: 66,066,579 (GRCm39) I358T probably benign Het
Tuba8 A G 6: 121,202,863 (GRCm39) D392G possibly damaging Het
Vmn1r1 G A 1: 181,984,972 (GRCm39) P231L probably damaging Het
Zfp330 A G 8: 83,493,941 (GRCm39) W107R probably damaging Het
Zfp715 T A 7: 42,949,116 (GRCm39) Q281H possibly damaging Het
Zfp9 T C 6: 118,442,000 (GRCm39) T221A probably damaging Het
Zgpat T C 2: 181,007,420 (GRCm39) probably benign Het
Other mutations in Slc22a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slc22a23 APN 13 34,489,228 (GRCm39) missense probably damaging 1.00
IGL01762:Slc22a23 APN 13 34,387,984 (GRCm39) missense possibly damaging 0.71
IGL02496:Slc22a23 APN 13 34,528,468 (GRCm39) missense possibly damaging 0.93
IGL02516:Slc22a23 APN 13 34,387,938 (GRCm39) missense probably benign 0.02
IGL02831:Slc22a23 APN 13 34,483,052 (GRCm39) missense possibly damaging 0.81
Foreshadowed UTSW 13 34,379,462 (GRCm39) missense probably damaging 0.98
foretold UTSW 13 34,489,163 (GRCm39) missense probably benign 0.08
BB009:Slc22a23 UTSW 13 34,366,960 (GRCm39) missense probably damaging 0.99
BB019:Slc22a23 UTSW 13 34,366,960 (GRCm39) missense probably damaging 0.99
R0234:Slc22a23 UTSW 13 34,367,244 (GRCm39) missense probably damaging 1.00
R0234:Slc22a23 UTSW 13 34,367,244 (GRCm39) missense probably damaging 1.00
R0413:Slc22a23 UTSW 13 34,367,115 (GRCm39) missense probably damaging 1.00
R0557:Slc22a23 UTSW 13 34,528,366 (GRCm39) missense possibly damaging 0.50
R0558:Slc22a23 UTSW 13 34,528,366 (GRCm39) missense possibly damaging 0.50
R0636:Slc22a23 UTSW 13 34,483,076 (GRCm39) missense probably benign 0.01
R0676:Slc22a23 UTSW 13 34,379,462 (GRCm39) missense probably damaging 0.98
R0739:Slc22a23 UTSW 13 34,528,366 (GRCm39) missense possibly damaging 0.50
R0990:Slc22a23 UTSW 13 34,379,450 (GRCm39) missense probably damaging 1.00
R1515:Slc22a23 UTSW 13 34,387,947 (GRCm39) missense probably benign 0.33
R2128:Slc22a23 UTSW 13 34,387,953 (GRCm39) missense possibly damaging 0.76
R2147:Slc22a23 UTSW 13 34,366,990 (GRCm39) missense probably benign 0.00
R3113:Slc22a23 UTSW 13 34,367,058 (GRCm39) missense probably damaging 0.98
R3780:Slc22a23 UTSW 13 34,528,323 (GRCm39) missense probably benign 0.14
R3945:Slc22a23 UTSW 13 34,367,109 (GRCm39) missense probably damaging 0.98
R3946:Slc22a23 UTSW 13 34,367,109 (GRCm39) missense probably damaging 0.98
R4056:Slc22a23 UTSW 13 34,482,987 (GRCm39) nonsense probably null
R4095:Slc22a23 UTSW 13 34,489,189 (GRCm39) missense probably damaging 1.00
R4854:Slc22a23 UTSW 13 34,387,924 (GRCm39) missense probably benign
R5611:Slc22a23 UTSW 13 34,489,222 (GRCm39) missense probably benign 0.00
R6167:Slc22a23 UTSW 13 34,528,542 (GRCm39) missense probably damaging 0.97
R6927:Slc22a23 UTSW 13 34,528,362 (GRCm39) missense probably benign 0.07
R6933:Slc22a23 UTSW 13 34,489,163 (GRCm39) missense probably benign 0.08
R6960:Slc22a23 UTSW 13 34,528,140 (GRCm39) critical splice donor site probably null
R7291:Slc22a23 UTSW 13 34,381,822 (GRCm39) missense probably damaging 0.99
R7313:Slc22a23 UTSW 13 34,367,161 (GRCm39) missense probably damaging 1.00
R7932:Slc22a23 UTSW 13 34,366,960 (GRCm39) missense probably damaging 0.99
R8058:Slc22a23 UTSW 13 34,489,167 (GRCm39) nonsense probably null
R9385:Slc22a23 UTSW 13 34,528,561 (GRCm39) missense probably benign 0.05
R9560:Slc22a23 UTSW 13 34,381,851 (GRCm39) missense possibly damaging 0.51
R9630:Slc22a23 UTSW 13 34,379,390 (GRCm39) missense possibly damaging 0.93
X0064:Slc22a23 UTSW 13 34,528,449 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCTCTTCTGGCATCAG -3'
(R):5'- TTGGATTTTCAGCAGCCCAC -3'

Sequencing Primer
(F):5'- AGTGACCCGGAGCTAACC -3'
(R):5'- AGCAGCCCACGATGATATTCTTC -3'
Posted On 2016-10-26