Incidental Mutation 'R5594:Slc12a7'
ID437724
Institutional Source Beutler Lab
Gene Symbol Slc12a7
Ensembl Gene ENSMUSG00000017756
Gene Namesolute carrier family 12, member 7
SynonymsKcc4
MMRRC Submission 043146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5594 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73733094-73816754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73785139 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 105 (D105E)
Ref Sequence ENSEMBL: ENSMUSP00000017900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017900] [ENSMUST00000220535]
Predicted Effect probably benign
Transcript: ENSMUST00000017900
AA Change: D105E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017900
Gene: ENSMUSG00000017756
AA Change: D105E

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 99 113 N/A INTRINSIC
Pfam:AA_permease 123 308 1e-22 PFAM
low complexity region 390 407 N/A INTRINSIC
Pfam:AA_permease 410 696 1.5e-40 PFAM
Pfam:SLC12 708 834 4.6e-18 PFAM
Pfam:SLC12 818 1083 2.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220522
Predicted Effect probably benign
Transcript: ENSMUST00000220535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222742
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Hearing is severely impaired in homozygous mutant mice, which also exhibit renal tubular acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
4931414P19Rik A G 14: 54,584,984 Y399H probably damaging Het
5430419D17Rik T A 7: 131,239,523 D647E probably benign Het
6430573F11Rik A G 8: 36,512,298 T352A probably benign Het
Abca9 G T 11: 110,144,862 P644Q probably damaging Het
Acly T C 11: 100,522,120 probably null Het
Adamts14 A T 10: 61,227,101 probably null Het
Ankdd1a T C 9: 65,502,241 N471S probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Arhgef28 T C 13: 97,939,492 T1345A probably benign Het
Arhgef40 T A 14: 51,996,157 L820H probably damaging Het
Atp2b4 A G 1: 133,730,510 V554A probably damaging Het
Birc7 G A 2: 180,933,336 probably null Het
Ccdc80 C T 16: 45,116,263 R684C probably benign Het
Cdc25b C A 2: 131,191,618 P159Q probably damaging Het
Chek2 G T 5: 110,855,834 probably null Het
Chil6 C T 3: 106,394,429 probably null Het
Cr2 A G 1: 195,157,190 I643T probably damaging Het
Cwf19l2 C A 9: 3,418,773 Q187K probably benign Het
Cyth4 A G 15: 78,607,075 probably null Het
Depdc5 A G 5: 32,901,490 T268A possibly damaging Het
Dnah17 G T 11: 118,043,229 probably null Het
Dnah3 T C 7: 119,971,621 Y2210C possibly damaging Het
Elmod3 G A 6: 72,594,816 probably benign Het
Eogt T A 6: 97,116,035 T394S probably benign Het
Evi5 A G 5: 107,820,451 V182A possibly damaging Het
Fbxo30 T C 10: 11,290,479 I315T probably benign Het
Fibcd1 T C 2: 31,838,617 N76S probably damaging Het
Gcc2 G T 10: 58,287,242 R1190M probably damaging Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Glg1 G A 8: 111,187,881 R424C probably damaging Het
Gm11543 T A 11: 94,828,554 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hhip G T 8: 79,996,863 D387E probably damaging Het
Hif1a T A 12: 73,937,792 Y46* probably null Het
Hivep3 G T 4: 120,123,048 probably null Het
Kif13a T A 13: 46,752,862 E535V probably damaging Het
Lrch3 T C 16: 32,914,184 Y15H probably damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Lyst T A 13: 13,759,397 V3560E probably benign Het
Megf11 T C 9: 64,686,473 F613L probably damaging Het
Misp G A 10: 79,827,143 V465M probably damaging Het
Ms4a6c T A 19: 11,478,173 D115E probably benign Het
Msh6 A G 17: 87,986,069 T751A probably benign Het
Ntrk3 T A 7: 78,451,899 T429S probably benign Het
Olfr128 T A 17: 37,923,611 M15K probably benign Het
Olfr857 T C 9: 19,713,006 Y60H probably damaging Het
Oplah A C 15: 76,296,637 *1289G probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhga6 A T 18: 37,708,528 T434S probably benign Het
Pign A G 1: 105,646,869 probably benign Het
Poteg A T 8: 27,447,968 I51F probably benign Het
Prrc2c C A 1: 162,699,031 V204F unknown Het
Rhbdd3 T C 11: 5,105,710 S325P probably damaging Het
Rit1 T A 3: 88,729,137 L116Q probably damaging Het
Rpl22 T A 4: 152,325,802 probably benign Het
Rttn A G 18: 89,090,436 E1588G possibly damaging Het
Sardh A G 2: 27,220,723 F577S probably damaging Het
Slc22a23 T A 13: 34,305,257 D215V probably damaging Het
Slc4a8 C A 15: 100,795,887 P438T probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Stk19 C T 17: 34,820,562 probably benign Het
Stx5a T C 19: 8,748,465 I143T probably damaging Het
Tep1 T C 14: 50,829,882 H2232R possibly damaging Het
Ttc21b A G 2: 66,236,235 I358T probably benign Het
Tuba8 A G 6: 121,225,904 D392G possibly damaging Het
Vmn1r1 G A 1: 182,157,407 P231L probably damaging Het
Zfp330 A G 8: 82,767,312 W107R probably damaging Het
Zfp715 T A 7: 43,299,692 Q281H possibly damaging Het
Zfp9 T C 6: 118,465,039 T221A probably damaging Het
Zgpat T C 2: 181,365,627 probably benign Het
Other mutations in Slc12a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc12a7 APN 13 73794082 missense possibly damaging 0.77
IGL01086:Slc12a7 APN 13 73814843 missense probably damaging 1.00
IGL01344:Slc12a7 APN 13 73792737 missense probably damaging 1.00
IGL01739:Slc12a7 APN 13 73799614 missense probably benign 0.00
IGL02039:Slc12a7 APN 13 73809094 critical splice donor site probably null
IGL02213:Slc12a7 APN 13 73797703 critical splice donor site probably null
IGL02285:Slc12a7 APN 13 73795595 unclassified probably benign
IGL02422:Slc12a7 APN 13 73806161 missense probably benign 0.18
IGL02423:Slc12a7 APN 13 73763763 utr 5 prime probably benign
IGL02596:Slc12a7 APN 13 73785123 missense probably benign 0.01
IGL02794:Slc12a7 APN 13 73809087 missense possibly damaging 0.68
IGL02813:Slc12a7 APN 13 73813676 unclassified probably benign
IGL02868:Slc12a7 APN 13 73806388 missense probably benign
R0828:Slc12a7 UTSW 13 73788652 missense probably benign 0.03
R1440:Slc12a7 UTSW 13 73801008 missense probably damaging 1.00
R1659:Slc12a7 UTSW 13 73790671 missense probably damaging 1.00
R1669:Slc12a7 UTSW 13 73795113 missense probably benign 0.00
R2111:Slc12a7 UTSW 13 73785155 nonsense probably null
R3023:Slc12a7 UTSW 13 73800422 missense probably benign 0.07
R3612:Slc12a7 UTSW 13 73809923 missense probably benign 0.30
R4210:Slc12a7 UTSW 13 73814843 missense probably damaging 1.00
R4353:Slc12a7 UTSW 13 73790734 missense possibly damaging 0.63
R4761:Slc12a7 UTSW 13 73813589 missense probably benign 0.06
R4801:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R4802:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R5002:Slc12a7 UTSW 13 73763777 missense possibly damaging 0.66
R5128:Slc12a7 UTSW 13 73805433 missense probably benign 0.03
R5760:Slc12a7 UTSW 13 73813622 missense probably damaging 1.00
R5854:Slc12a7 UTSW 13 73793940 missense probably benign 0.03
R6233:Slc12a7 UTSW 13 73805471 missense possibly damaging 0.63
R6693:Slc12a7 UTSW 13 73797537 missense probably benign 0.00
R6782:Slc12a7 UTSW 13 73798969 missense probably damaging 0.99
R7169:Slc12a7 UTSW 13 73784560 missense probably benign 0.30
R7225:Slc12a7 UTSW 13 73763962 intron probably benign
R7458:Slc12a7 UTSW 13 73785069 missense probably damaging 1.00
R7534:Slc12a7 UTSW 13 73764068 intron probably benign
R7565:Slc12a7 UTSW 13 73790772 missense possibly damaging 0.58
R7660:Slc12a7 UTSW 13 73806089 missense probably benign
R7737:Slc12a7 UTSW 13 73788677 missense probably benign 0.01
R7783:Slc12a7 UTSW 13 73805469 missense probably benign 0.44
R7875:Slc12a7 UTSW 13 73788604 missense possibly damaging 0.94
R7958:Slc12a7 UTSW 13 73788604 missense possibly damaging 0.94
R8017:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8019:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
X0023:Slc12a7 UTSW 13 73788608 missense possibly damaging 0.94
X0028:Slc12a7 UTSW 13 73798541 splice site probably null
X0065:Slc12a7 UTSW 13 73800945 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGGACAGATGGATCTCCTG -3'
(R):5'- GCCTGCACATGACTTCTAGGAC -3'

Sequencing Primer
(F):5'- AGATGGATCTCCTGGGCCAG -3'
(R):5'- GCACATGACTTCTAGGACCTTGTC -3'
Posted On2016-10-26