Incidental Mutation 'R0063:Nat8f2'
ID43775
Institutional Source Beutler Lab
Gene Symbol Nat8f2
Ensembl Gene ENSMUSG00000033634
Gene NameN-acetyltransferase 8 (GCN5-related) family member 2
SynonymsCml2
MMRRC Submission 038355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0063 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location85865422-85869158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85867833 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 182 (S182R)
Ref Sequence ENSEMBL: ENSMUSP00000044587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045008]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045008
AA Change: S182R

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044587
Gene: ENSMUSG00000033634
AA Change: S182R

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:Acetyltransf_10 77 192 4.9e-14 PFAM
Pfam:Acetyltransf_9 79 195 1.1e-9 PFAM
Pfam:Acetyltransf_4 84 205 1.1e-9 PFAM
Pfam:Acetyltransf_8 86 205 6.9e-12 PFAM
Pfam:Acetyltransf_7 104 194 2e-14 PFAM
Pfam:Acetyltransf_1 111 193 1e-17 PFAM
Pfam:FR47 130 200 5.1e-8 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik C T 16: 4,861,048 R245* probably null Het
4930563I02Rik T A 14: 60,096,028 probably benign Het
9330182L06Rik T C 5: 9,440,709 probably benign Het
Acss1 T C 2: 150,627,292 T435A probably damaging Het
Aoc2 T A 11: 101,326,071 S327T probably damaging Het
Arid5a T A 1: 36,318,564 Y252N probably damaging Het
AU040320 T C 4: 126,839,672 Y662H probably damaging Het
B4gat1 T A 19: 5,039,707 L244* probably null Het
Bcam C T 7: 19,766,848 V134I probably benign Het
Btbd16 A T 7: 130,823,166 T426S probably benign Het
Btn1a1 C T 13: 23,465,097 probably null Het
Cap2 T C 13: 46,638,032 probably benign Het
Capn8 T A 1: 182,602,112 D299E probably damaging Het
Cdipt G A 7: 126,979,600 V160I probably benign Het
Cep164 A G 9: 45,768,618 S1267P possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col3a1 T C 1: 45,330,541 probably benign Het
Cyb5r3 T C 15: 83,161,936 T60A probably benign Het
Dgkb T G 12: 38,604,113 S744A probably benign Het
Dock2 T A 11: 34,756,284 probably null Het
Ece1 C T 4: 137,948,581 T422M probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Eml3 C A 19: 8,938,478 A644D probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Foxp1 A G 6: 98,944,723 probably benign Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Il17rd G A 14: 27,082,733 C88Y probably damaging Het
Il17rd C A 14: 27,082,734 C88* probably null Het
Ino80c A G 18: 24,106,624 F160S probably damaging Het
Ints8 T C 4: 11,252,857 N75S probably damaging Het
Irf2bp1 C T 7: 19,005,847 R471C possibly damaging Het
Irs1 T A 1: 82,288,859 E545D probably damaging Het
Lama3 T C 18: 12,528,705 probably benign Het
Mast4 C A 13: 103,334,215 probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Nrcam G T 12: 44,550,028 V343F possibly damaging Het
Opn5 T C 17: 42,596,626 S120G probably damaging Het
Pdk2 T C 11: 95,032,480 H106R probably benign Het
Pkhd1 G A 1: 20,211,950 T2889I probably benign Het
Pkhd1l1 T A 15: 44,529,237 L1656H probably damaging Het
Plxna2 A T 1: 194,644,939 T394S probably benign Het
Pnpla8 T A 12: 44,282,832 C56S probably damaging Het
Prdm8 G T 5: 98,184,594 R118L probably damaging Het
Prkce T C 17: 86,482,111 probably benign Het
Ptprk T A 10: 28,263,767 Y163N probably damaging Het
Rbbp8 T A 18: 11,734,557 probably benign Het
Rnh1 A T 7: 141,164,196 probably null Het
Rtn4 T A 11: 29,705,527 probably benign Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Slc2a2 T C 3: 28,717,440 M173T probably damaging Het
Slc2a8 T A 2: 32,979,999 probably null Het
Tdpoz1 A T 3: 93,670,814 M221K probably benign Het
Tgm7 G T 2: 121,094,096 H533Q probably benign Het
Timm29 C A 9: 21,593,008 A17E probably benign Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tmem89 A G 9: 108,914,812 N60S probably benign Het
Tpx2 A G 2: 152,880,123 T212A probably damaging Het
Trio G T 15: 27,881,437 probably benign Het
Tulp2 T C 7: 45,520,860 probably benign Het
Uggt2 A G 14: 119,007,130 probably benign Het
Vmn2r5 T A 3: 64,503,800 E449V probably benign Het
Vwa8 A G 14: 79,164,216 probably benign Het
Xirp2 A G 2: 67,509,083 D556G probably damaging Het
Xrn1 T C 9: 95,969,535 L202P probably damaging Het
Zfp354a A T 11: 51,069,571 H203L probably damaging Het
Zfp53 A C 17: 21,508,105 R133S probably benign Het
Zfp787 C T 7: 6,132,323 probably null Het
Other mutations in Nat8f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Nat8f2 UTSW 6 85867686 missense possibly damaging 0.84
FR4737:Nat8f2 UTSW 6 85867686 missense possibly damaging 0.84
R0063:Nat8f2 UTSW 6 85867833 missense possibly damaging 0.50
R0384:Nat8f2 UTSW 6 85868368 missense possibly damaging 0.63
R0532:Nat8f2 UTSW 6 85867802 missense probably benign 0.01
R2143:Nat8f2 UTSW 6 85868257 missense probably benign 0.00
R3698:Nat8f2 UTSW 6 85867796 missense probably benign 0.16
R4335:Nat8f2 UTSW 6 85868251 missense probably damaging 1.00
R5369:Nat8f2 UTSW 6 85867872 nonsense probably null
R5484:Nat8f2 UTSW 6 85868012 missense possibly damaging 0.76
R5714:Nat8f2 UTSW 6 85867909 missense probably benign 0.43
R6737:Nat8f2 UTSW 6 85868212 missense probably benign 0.00
R7676:Nat8f2 UTSW 6 85868212 missense probably benign 0.00
R8054:Nat8f2 UTSW 6 85867772 missense probably benign 0.00
Z1176:Nat8f2 UTSW 6 85868044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTGAAGCCTTCTGGACACAC -3'
(R):5'- AAGCAGATGCAGCTCTTTCGCC -3'

Sequencing Primer
(F):5'- ggatgagaagccagaagcac -3'
(R):5'- CTGTCTGTGTCCTCACAGC -3'
Posted On2013-05-29