Incidental Mutation 'R5595:Fgfr3'
ID437763
Institutional Source Beutler Lab
Gene Symbol Fgfr3
Ensembl Gene ENSMUSG00000054252
Gene Namefibroblast growth factor receptor 3
Synonymssam3, Fgfr-3, HBGFR
MMRRC Submission 043147-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R5595 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location33721674-33737068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33730003 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 204 (C204Y)
Ref Sequence ENSEMBL: ENSMUSP00000143945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067150] [ENSMUST00000087820] [ENSMUST00000114411] [ENSMUST00000155002] [ENSMUST00000164207] [ENSMUST00000169212] [ENSMUST00000171509] [ENSMUST00000201295] [ENSMUST00000201437] [ENSMUST00000202138]
Predicted Effect probably damaging
Transcript: ENSMUST00000067150
AA Change: C222Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070998
Gene: ENSMUSG00000054252
AA Change: C222Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 466 742 3.14e-153 SMART
low complexity region 765 781 N/A INTRINSIC
low complexity region 789 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087820
AA Change: C204Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085122
Gene: ENSMUSG00000054252
AA Change: C204Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
IGc2 143 211 1.2e-15 SMART
IGc2 242 322 3.28e-8 SMART
transmembrane domain 349 371 N/A INTRINSIC
TyrKc 448 724 3.14e-153 SMART
low complexity region 747 763 N/A INTRINSIC
low complexity region 771 780 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114411
AA Change: C222Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110053
Gene: ENSMUSG00000054252
AA Change: C222Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 339 2.77e-6 SMART
transmembrane domain 369 391 N/A INTRINSIC
TyrKc 468 744 3.14e-153 SMART
low complexity region 767 783 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152661
Predicted Effect probably benign
Transcript: ENSMUST00000155002
Predicted Effect probably damaging
Transcript: ENSMUST00000164207
AA Change: C222Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133064
Gene: ENSMUSG00000054252
AA Change: C222Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 467 743 3.14e-153 SMART
low complexity region 766 782 N/A INTRINSIC
low complexity region 790 799 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169212
AA Change: C222Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130856
Gene: ENSMUSG00000054252
AA Change: C222Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 466 742 3.14e-153 SMART
low complexity region 765 781 N/A INTRINSIC
low complexity region 789 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171509
AA Change: C222Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131845
Gene: ENSMUSG00000054252
AA Change: C222Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 339 2.77e-6 SMART
transmembrane domain 369 391 N/A INTRINSIC
TyrKc 468 744 3.14e-153 SMART
low complexity region 767 783 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000181298
AA Change: C60Y
Predicted Effect probably benign
Transcript: ENSMUST00000201295
SMART Domains Protein: ENSMUSP00000144104
Gene: ENSMUSG00000054252

DomainStartEndE-ValueType
IG 11 71 1.9e-3 SMART
transmembrane domain 90 112 N/A INTRINSIC
PDB:2PSQ|B 126 223 2e-30 PDB
Blast:IG_like 140 223 2e-51 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000201437
SMART Domains Protein: ENSMUSP00000144379
Gene: ENSMUSG00000054252

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 2e-6 SMART
Pfam:Ig_3 144 194 2.1e-3 PFAM
Pfam:I-set 153 194 9.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202138
AA Change: C204Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143945
Gene: ENSMUSG00000054252
AA Change: C204Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
IGc2 143 211 1.2e-15 SMART
IGc2 242 322 3.28e-8 SMART
transmembrane domain 349 371 N/A INTRINSIC
TyrKc 448 724 3.14e-153 SMART
low complexity region 747 763 N/A INTRINSIC
low complexity region 771 780 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202182
AA Change: C215Y
Predicted Effect probably benign
Transcript: ENSMUST00000202791
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the fibroblast growth factor receptor family. Members of this family are highly conserved proteins that differ from one another in their ligand affinities and tissue distribution. A representative protein consists of an extracellular region composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment, and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This family member binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in this gene may be associated with craniosynostosis and multiple types of skeletal dysplasia. A pseudogene of this gene is located on chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mutant alleles generally cause skeletal deformities, with some causing decreased body size, premature death, or hearing loss due to developmental defects of the ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,864,279 F991S probably benign Het
4931406B18Rik A G 7: 43,497,872 I218T possibly damaging Het
4931440F15Rik T C 11: 29,824,288 N390D probably benign Het
9930111J21Rik2 C T 11: 49,019,711 A632T possibly damaging Het
Akt1 A T 12: 112,658,616 L166Q probably null Het
Alpk2 A T 18: 65,266,248 D2086E probably damaging Het
Ankrd11 A T 8: 122,894,304 C915* probably null Het
Ankrd44 A T 1: 54,735,050 I398K probably damaging Het
Ankrd44 T C 1: 54,762,347 T274A probably damaging Het
Arhgef2 A G 3: 88,642,976 T663A probably benign Het
BC048403 T C 10: 121,740,147 probably benign Het
Btbd16 G A 7: 130,823,303 M471I possibly damaging Het
Btbd16 C A 7: 130,823,304 Q472K probably damaging Het
Cdc37 G A 9: 21,143,213 R39C probably damaging Het
Cnnm1 A G 19: 43,465,157 N537S possibly damaging Het
Cop1 T A 1: 159,250,073 D159E probably benign Het
Crtac1 C T 19: 42,413,951 V73I probably benign Het
Cryz T A 3: 154,606,518 V84E probably damaging Het
Ctnnd2 C T 15: 30,669,543 L433F probably benign Het
Ctsq C A 13: 61,037,060 D271Y probably benign Het
Cyp3a25 A C 5: 145,994,863 probably null Het
Dmbt1 G C 7: 131,054,067 W412C probably benign Het
Eif4e1b G A 13: 54,786,716 V131I possibly damaging Het
Epha1 A G 6: 42,364,634 V494A possibly damaging Het
Fbxl4 T C 4: 22,433,641 S593P probably damaging Het
Fbxo41 G A 6: 85,479,901 P429S probably benign Het
Gbf1 T C 19: 46,284,422 V1665A possibly damaging Het
Htt T A 5: 34,905,397 V2825E probably damaging Het
Irs1 A T 1: 82,289,925 V190E probably damaging Het
Klk1 T C 7: 44,228,737 probably null Het
Kmt2d T C 15: 98,850,024 probably benign Het
Meox1 T C 11: 101,879,343 E186G probably damaging Het
Micu2 G A 14: 57,971,744 R86W probably damaging Het
Mrgprb1 A T 7: 48,447,684 I160K probably damaging Het
Nckap1l T A 15: 103,475,658 M561K possibly damaging Het
Olfr1199 A T 2: 88,756,405 I90N probably damaging Het
Olfr605 A T 7: 103,442,428 S232T probably damaging Het
Olfr689 A T 7: 105,314,006 M1L probably benign Het
Otoa T A 7: 121,121,977 L405H probably damaging Het
Phyhip A T 14: 70,466,874 M178L probably benign Het
Pkd1l3 A T 8: 109,655,520 N1630I probably damaging Het
Plek2 T A 12: 78,894,109 T247S probably benign Het
Rhbdl3 T C 11: 80,337,583 V293A probably damaging Het
Rock2 T A 12: 16,942,809 F193Y probably damaging Het
Scn3a C T 2: 65,460,713 M1896I probably benign Het
Snrnp200 T C 2: 127,226,013 V810A probably damaging Het
Taar4 G A 10: 23,960,741 S83N probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tec T A 5: 72,768,744 I322F possibly damaging Het
Teddm2 T C 1: 153,850,400 I190V probably benign Het
Tmem117 A G 15: 95,094,884 E475G probably damaging Het
Trip10 T A 17: 57,262,460 Y495N probably damaging Het
Ush2a T C 1: 188,906,498 V4035A possibly damaging Het
Utrn C T 10: 12,682,318 V1466M possibly damaging Het
Vasp A G 7: 19,257,891 probably benign Het
Vmn1r89 A T 7: 13,219,930 M130L possibly damaging Het
Vmn2r2 A T 3: 64,126,615 D495E possibly damaging Het
Zfp213 A G 17: 23,561,186 V120A possibly damaging Het
Other mutations in Fgfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Fgfr3 APN 5 33735140 missense possibly damaging 0.57
IGL01585:Fgfr3 APN 5 33733961 missense probably damaging 0.96
IGL03266:Fgfr3 APN 5 33734365 missense probably damaging 1.00
IGL03285:Fgfr3 APN 5 33735213 missense probably damaging 1.00
PIT4280001:Fgfr3 UTSW 5 33732232 missense probably benign 0.13
R0543:Fgfr3 UTSW 5 33729710 start codon destroyed probably null 0.00
R0604:Fgfr3 UTSW 5 33732782 missense probably damaging 0.99
R1496:Fgfr3 UTSW 5 33729750 missense probably damaging 0.96
R1861:Fgfr3 UTSW 5 33729746 missense probably damaging 1.00
R2919:Fgfr3 UTSW 5 33733940 missense probably damaging 1.00
R2920:Fgfr3 UTSW 5 33733940 missense probably damaging 1.00
R4361:Fgfr3 UTSW 5 33723332 intron probably benign
R4506:Fgfr3 UTSW 5 33729999 missense probably damaging 1.00
R4513:Fgfr3 UTSW 5 33723116 intron probably benign
R4647:Fgfr3 UTSW 5 33734986 unclassified probably benign
R5240:Fgfr3 UTSW 5 33730038 missense probably damaging 1.00
R5251:Fgfr3 UTSW 5 33735556 unclassified probably benign
R5454:Fgfr3 UTSW 5 33723298 intron probably benign
R5984:Fgfr3 UTSW 5 33729705 missense probably damaging 1.00
R6753:Fgfr3 UTSW 5 33732159 missense probably benign 0.35
R6985:Fgfr3 UTSW 5 33735441 missense probably null 1.00
R7106:Fgfr3 UTSW 5 33731414 missense probably damaging 1.00
R7221:Fgfr3 UTSW 5 33732748 frame shift probably null
R7319:Fgfr3 UTSW 5 33727802 missense possibly damaging 0.88
R7373:Fgfr3 UTSW 5 33727690 missense probably benign 0.00
R7497:Fgfr3 UTSW 5 33735422 frame shift probably null
R7498:Fgfr3 UTSW 5 33735422 frame shift probably null
R7499:Fgfr3 UTSW 5 33735422 frame shift probably null
R7883:Fgfr3 UTSW 5 33733891 missense probably damaging 1.00
R7966:Fgfr3 UTSW 5 33733891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATTCCGAGGGGAGCATC -3'
(R):5'- TCCACGTCACTGCCTAGAATG -3'

Sequencing Primer
(F):5'- CATCGCATTGGGGGCATCAAG -3'
(R):5'- CCTAGAATGGCTGTCTGGTTG -3'
Posted On2016-10-26