Incidental Mutation 'R5595:Tec'
ID437765
Institutional Source Beutler Lab
Gene Symbol Tec
Ensembl Gene ENSMUSG00000029217
Gene Nametec protein tyrosine kinase
Synonyms
MMRRC Submission 043147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5595 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location72755716-72868483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72768744 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 322 (I322F)
Ref Sequence ENSEMBL: ENSMUSP00000109224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071944] [ENSMUST00000073843] [ENSMUST00000113594] [ENSMUST00000126481] [ENSMUST00000138842] [ENSMUST00000149533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071944
AA Change: I322F

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071836
Gene: ENSMUSG00000029217
AA Change: I322F

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073843
AA Change: I300F

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073509
Gene: ENSMUSG00000029217
AA Change: I300F

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 230 2.85e-3 SMART
SH2 222 313 9.96e-28 SMART
TyrKc 347 596 2.13e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113594
AA Change: I322F

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109224
Gene: ENSMUSG00000029217
AA Change: I322F

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126481
SMART Domains Protein: ENSMUSP00000123606
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138842
SMART Domains Protein: ENSMUSP00000120155
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149533
SMART Domains Protein: ENSMUSP00000123258
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155342
SMART Domains Protein: ENSMUSP00000118980
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
BTK 2 33 8.62e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tec family of non-receptor protein-tyrosine kinases containing a pleckstrin homology domain. Tec family kinases are involved in the intracellular signaling mechanisms of cytokine receptors, lymphocyte surface antigens, heterotrimeric G-protein coupled receptors, and integrin molecules. They are also key players in the regulation of the immune functions. Tec kinase is an integral component of T cell signaling and has a distinct role in T cell activation. This gene may be associated with myelodysplastic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a minor reduction in platetet aggregation in response to threshold concentrations of collagen-related peptide or collagen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,864,279 F991S probably benign Het
4931406B18Rik A G 7: 43,497,872 I218T possibly damaging Het
4931440F15Rik T C 11: 29,824,288 N390D probably benign Het
9930111J21Rik2 C T 11: 49,019,711 A632T possibly damaging Het
Akt1 A T 12: 112,658,616 L166Q probably null Het
Alpk2 A T 18: 65,266,248 D2086E probably damaging Het
Ankrd11 A T 8: 122,894,304 C915* probably null Het
Ankrd44 A T 1: 54,735,050 I398K probably damaging Het
Ankrd44 T C 1: 54,762,347 T274A probably damaging Het
Arhgef2 A G 3: 88,642,976 T663A probably benign Het
BC048403 T C 10: 121,740,147 probably benign Het
Btbd16 C A 7: 130,823,304 Q472K probably damaging Het
Btbd16 G A 7: 130,823,303 M471I possibly damaging Het
Cdc37 G A 9: 21,143,213 R39C probably damaging Het
Cnnm1 A G 19: 43,465,157 N537S possibly damaging Het
Cop1 T A 1: 159,250,073 D159E probably benign Het
Crtac1 C T 19: 42,413,951 V73I probably benign Het
Cryz T A 3: 154,606,518 V84E probably damaging Het
Ctnnd2 C T 15: 30,669,543 L433F probably benign Het
Ctsq C A 13: 61,037,060 D271Y probably benign Het
Cyp3a25 A C 5: 145,994,863 probably null Het
Dmbt1 G C 7: 131,054,067 W412C probably benign Het
Eif4e1b G A 13: 54,786,716 V131I possibly damaging Het
Epha1 A G 6: 42,364,634 V494A possibly damaging Het
Fbxl4 T C 4: 22,433,641 S593P probably damaging Het
Fbxo41 G A 6: 85,479,901 P429S probably benign Het
Fgfr3 G A 5: 33,730,003 C204Y probably damaging Het
Gbf1 T C 19: 46,284,422 V1665A possibly damaging Het
Htt T A 5: 34,905,397 V2825E probably damaging Het
Irs1 A T 1: 82,289,925 V190E probably damaging Het
Klk1 T C 7: 44,228,737 probably null Het
Kmt2d T C 15: 98,850,024 probably benign Het
Meox1 T C 11: 101,879,343 E186G probably damaging Het
Micu2 G A 14: 57,971,744 R86W probably damaging Het
Mrgprb1 A T 7: 48,447,684 I160K probably damaging Het
Nckap1l T A 15: 103,475,658 M561K possibly damaging Het
Olfr1199 A T 2: 88,756,405 I90N probably damaging Het
Olfr605 A T 7: 103,442,428 S232T probably damaging Het
Olfr689 A T 7: 105,314,006 M1L probably benign Het
Otoa T A 7: 121,121,977 L405H probably damaging Het
Phyhip A T 14: 70,466,874 M178L probably benign Het
Pkd1l3 A T 8: 109,655,520 N1630I probably damaging Het
Plek2 T A 12: 78,894,109 T247S probably benign Het
Rhbdl3 T C 11: 80,337,583 V293A probably damaging Het
Rock2 T A 12: 16,942,809 F193Y probably damaging Het
Scn3a C T 2: 65,460,713 M1896I probably benign Het
Snrnp200 T C 2: 127,226,013 V810A probably damaging Het
Taar4 G A 10: 23,960,741 S83N probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Teddm2 T C 1: 153,850,400 I190V probably benign Het
Tmem117 A G 15: 95,094,884 E475G probably damaging Het
Trip10 T A 17: 57,262,460 Y495N probably damaging Het
Ush2a T C 1: 188,906,498 V4035A possibly damaging Het
Utrn C T 10: 12,682,318 V1466M possibly damaging Het
Vasp A G 7: 19,257,891 probably benign Het
Vmn1r89 A T 7: 13,219,930 M130L possibly damaging Het
Vmn2r2 A T 3: 64,126,615 D495E possibly damaging Het
Zfp213 A G 17: 23,561,186 V120A possibly damaging Het
Other mutations in Tec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Tec APN 5 72768768 missense probably damaging 1.00
IGL00980:Tec APN 5 72786798 missense probably damaging 1.00
IGL01986:Tec APN 5 72782005 nonsense probably null
IGL02505:Tec APN 5 72789244 missense probably damaging 1.00
IGL02522:Tec APN 5 72789172 missense probably benign 0.01
IGL02527:Tec APN 5 72779415 splice site probably null
IGL03292:Tec APN 5 72757364 missense probably null 0.98
IGL02988:Tec UTSW 5 72768747 missense possibly damaging 0.95
PIT4696001:Tec UTSW 5 72773835 missense possibly damaging 0.73
R0254:Tec UTSW 5 72763556 splice site probably benign
R0254:Tec UTSW 5 72783738 missense probably benign 0.12
R0646:Tec UTSW 5 72823497 missense probably damaging 1.00
R1122:Tec UTSW 5 72779449 missense probably damaging 0.96
R1495:Tec UTSW 5 72786755 missense probably damaging 1.00
R1617:Tec UTSW 5 72782105 missense probably damaging 0.97
R3905:Tec UTSW 5 72760362 missense probably damaging 1.00
R3953:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3954:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3955:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3981:Tec UTSW 5 72823599 utr 5 prime probably benign
R4061:Tec UTSW 5 72823409 unclassified probably benign
R4389:Tec UTSW 5 72782007 missense probably benign
R4507:Tec UTSW 5 72760358 missense probably damaging 1.00
R4689:Tec UTSW 5 72823637 start gained probably benign
R4702:Tec UTSW 5 72783731 missense possibly damaging 0.71
R4776:Tec UTSW 5 72768776 missense probably benign 0.38
R4911:Tec UTSW 5 72756351 missense probably benign 0.05
R4923:Tec UTSW 5 72782022 nonsense probably null
R4932:Tec UTSW 5 72760393 nonsense probably null
R7211:Tec UTSW 5 72782012 missense probably null 0.98
R7404:Tec UTSW 5 72763618 missense probably damaging 1.00
R7465:Tec UTSW 5 72773880 missense probably damaging 1.00
R7526:Tec UTSW 5 72786019 missense probably benign
R7548:Tec UTSW 5 72760350 missense probably damaging 1.00
R7699:Tec UTSW 5 72786024 missense possibly damaging 0.60
R7700:Tec UTSW 5 72786024 missense possibly damaging 0.60
R8021:Tec UTSW 5 72757469 missense probably benign 0.03
Z1177:Tec UTSW 5 72782015 missense possibly damaging 0.90
Z1177:Tec UTSW 5 72768707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGACATTAAAGTCCTGTAATGG -3'
(R):5'- CCCTTCTTTGGAGATTAATACCTATGG -3'

Sequencing Primer
(F):5'- GAACACGGTATCCTGTGAAATC -3'
(R):5'- TAGAGAAGGCTCATCAGG -3'
Posted On2016-10-26