Incidental Mutation 'R5595:Mrgprb1'
ID437771
Institutional Source Beutler Lab
Gene Symbol Mrgprb1
Ensembl Gene ENSMUSG00000070547
Gene NameMAS-related GPR, member B1
SynonymsMrgB1
MMRRC Submission 043147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5595 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48444113-48456342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48447684 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 160 (I160K)
Ref Sequence ENSEMBL: ENSMUSP00000091946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094384] [ENSMUST00000188095] [ENSMUST00000188918]
Predicted Effect probably damaging
Transcript: ENSMUST00000094384
AA Change: I160K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091946
Gene: ENSMUSG00000070547
AA Change: I160K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 227 5.5e-11 PFAM
Pfam:7tm_1 59 290 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188095
Predicted Effect probably benign
Transcript: ENSMUST00000188918
SMART Domains Protein: ENSMUSP00000140432
Gene: ENSMUSG00000070547

DomainStartEndE-ValueType
SCOP:d1l9ha_ 23 84 3e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,864,279 F991S probably benign Het
4931406B18Rik A G 7: 43,497,872 I218T possibly damaging Het
4931440F15Rik T C 11: 29,824,288 N390D probably benign Het
9930111J21Rik2 C T 11: 49,019,711 A632T possibly damaging Het
Akt1 A T 12: 112,658,616 L166Q probably null Het
Alpk2 A T 18: 65,266,248 D2086E probably damaging Het
Ankrd11 A T 8: 122,894,304 C915* probably null Het
Ankrd44 A T 1: 54,735,050 I398K probably damaging Het
Ankrd44 T C 1: 54,762,347 T274A probably damaging Het
Arhgef2 A G 3: 88,642,976 T663A probably benign Het
BC048403 T C 10: 121,740,147 probably benign Het
Btbd16 G A 7: 130,823,303 M471I possibly damaging Het
Btbd16 C A 7: 130,823,304 Q472K probably damaging Het
Cdc37 G A 9: 21,143,213 R39C probably damaging Het
Cnnm1 A G 19: 43,465,157 N537S possibly damaging Het
Cop1 T A 1: 159,250,073 D159E probably benign Het
Crtac1 C T 19: 42,413,951 V73I probably benign Het
Cryz T A 3: 154,606,518 V84E probably damaging Het
Ctnnd2 C T 15: 30,669,543 L433F probably benign Het
Ctsq C A 13: 61,037,060 D271Y probably benign Het
Cyp3a25 A C 5: 145,994,863 probably null Het
Dmbt1 G C 7: 131,054,067 W412C probably benign Het
Eif4e1b G A 13: 54,786,716 V131I possibly damaging Het
Epha1 A G 6: 42,364,634 V494A possibly damaging Het
Fbxl4 T C 4: 22,433,641 S593P probably damaging Het
Fbxo41 G A 6: 85,479,901 P429S probably benign Het
Fgfr3 G A 5: 33,730,003 C204Y probably damaging Het
Gbf1 T C 19: 46,284,422 V1665A possibly damaging Het
Htt T A 5: 34,905,397 V2825E probably damaging Het
Irs1 A T 1: 82,289,925 V190E probably damaging Het
Klk1 T C 7: 44,228,737 probably null Het
Kmt2d T C 15: 98,850,024 probably benign Het
Meox1 T C 11: 101,879,343 E186G probably damaging Het
Micu2 G A 14: 57,971,744 R86W probably damaging Het
Nckap1l T A 15: 103,475,658 M561K possibly damaging Het
Olfr1199 A T 2: 88,756,405 I90N probably damaging Het
Olfr605 A T 7: 103,442,428 S232T probably damaging Het
Olfr689 A T 7: 105,314,006 M1L probably benign Het
Otoa T A 7: 121,121,977 L405H probably damaging Het
Phyhip A T 14: 70,466,874 M178L probably benign Het
Pkd1l3 A T 8: 109,655,520 N1630I probably damaging Het
Plek2 T A 12: 78,894,109 T247S probably benign Het
Rhbdl3 T C 11: 80,337,583 V293A probably damaging Het
Rock2 T A 12: 16,942,809 F193Y probably damaging Het
Scn3a C T 2: 65,460,713 M1896I probably benign Het
Snrnp200 T C 2: 127,226,013 V810A probably damaging Het
Taar4 G A 10: 23,960,741 S83N probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tec T A 5: 72,768,744 I322F possibly damaging Het
Teddm2 T C 1: 153,850,400 I190V probably benign Het
Tmem117 A G 15: 95,094,884 E475G probably damaging Het
Trip10 T A 17: 57,262,460 Y495N probably damaging Het
Ush2a T C 1: 188,906,498 V4035A possibly damaging Het
Utrn C T 10: 12,682,318 V1466M possibly damaging Het
Vasp A G 7: 19,257,891 probably benign Het
Vmn1r89 A T 7: 13,219,930 M130L possibly damaging Het
Vmn2r2 A T 3: 64,126,615 D495E possibly damaging Het
Zfp213 A G 17: 23,561,186 V120A possibly damaging Het
Other mutations in Mrgprb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Mrgprb1 APN 7 48447543 missense probably damaging 0.99
IGL01141:Mrgprb1 APN 7 48448027 missense probably benign 0.36
IGL01393:Mrgprb1 APN 7 48448006 missense possibly damaging 0.48
IGL02430:Mrgprb1 APN 7 48447661 missense possibly damaging 0.95
IGL02485:Mrgprb1 APN 7 48447717 missense possibly damaging 0.88
R0026:Mrgprb1 UTSW 7 48447204 missense possibly damaging 0.66
R0051:Mrgprb1 UTSW 7 48447214 missense probably benign 0.01
R0789:Mrgprb1 UTSW 7 48456184 splice site probably benign
R1223:Mrgprb1 UTSW 7 48447687 missense possibly damaging 0.61
R1327:Mrgprb1 UTSW 7 48447429 missense possibly damaging 0.87
R1456:Mrgprb1 UTSW 7 48448029 missense probably damaging 0.98
R1561:Mrgprb1 UTSW 7 48447125 unclassified probably null
R1567:Mrgprb1 UTSW 7 48447453 missense probably damaging 0.97
R2030:Mrgprb1 UTSW 7 48447328 missense possibly damaging 0.83
R2165:Mrgprb1 UTSW 7 48447322 missense probably benign 0.00
R2885:Mrgprb1 UTSW 7 48447721 missense probably damaging 1.00
R3108:Mrgprb1 UTSW 7 48447328 missense possibly damaging 0.93
R3919:Mrgprb1 UTSW 7 48448081 missense probably benign 0.03
R4021:Mrgprb1 UTSW 7 48447123 missense possibly damaging 0.95
R4613:Mrgprb1 UTSW 7 48447708 missense possibly damaging 0.91
R4809:Mrgprb1 UTSW 7 48447991 missense possibly damaging 0.89
R5249:Mrgprb1 UTSW 7 48447477 missense possibly damaging 0.91
R5425:Mrgprb1 UTSW 7 48447971 missense possibly damaging 0.81
R5555:Mrgprb1 UTSW 7 48447775 missense probably benign 0.06
R5982:Mrgprb1 UTSW 7 48447820 missense probably benign 0.01
R6746:Mrgprb1 UTSW 7 48447897 missense possibly damaging 0.82
R7066:Mrgprb1 UTSW 7 48447676 missense probably benign 0.27
R7141:Mrgprb1 UTSW 7 48447687 missense possibly damaging 0.61
R7633:Mrgprb1 UTSW 7 48447583 missense probably benign 0.01
R8072:Mrgprb1 UTSW 7 48448147 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAGCACCAAGGCCAGACTG -3'
(R):5'- AGATGAGCAGGAATGCCTTCTC -3'

Sequencing Primer
(F):5'- GCCAGACTGGATCCCAAGAG -3'
(R):5'- GAGCAGGAATGCCTTCTCTGTCTAC -3'
Posted On2016-10-26