Incidental Mutation 'R5595:Btbd16'
ID437775
Institutional Source Beutler Lab
Gene Symbol Btbd16
Ensembl Gene ENSMUSG00000040298
Gene NameBTB (POZ) domain containing 16
SynonymsE330040A16Rik
MMRRC Submission 043147-MU
Accession Numbers

Genbank: NM_001081038.2; Ensembl: ENSMUST00000048453

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5595 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location130774069-130825899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130823303 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 471 (M471I)
Ref Sequence ENSEMBL: ENSMUSP00000146849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048453] [ENSMUST00000124096] [ENSMUST00000207219] [ENSMUST00000208593]
Predicted Effect probably benign
Transcript: ENSMUST00000048453
AA Change: M487I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000035433
Gene: ENSMUSG00000040298
AA Change: M487I

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Blast:BTB 97 222 3e-47 BLAST
SCOP:d1buoa_ 154 218 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207219
Predicted Effect possibly damaging
Transcript: ENSMUST00000208593
AA Change: M471I

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a BTB/POZ domain. This domain mediates protein-protein interactions. A mutation in this gene may be associated with bipolar disorder. [provided by RefSeq, Sep 2016]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,864,279 F991S probably benign Het
4931406B18Rik A G 7: 43,497,872 I218T possibly damaging Het
4931440F15Rik T C 11: 29,824,288 N390D probably benign Het
9930111J21Rik2 C T 11: 49,019,711 A632T possibly damaging Het
Akt1 A T 12: 112,658,616 L166Q probably null Het
Alpk2 A T 18: 65,266,248 D2086E probably damaging Het
Ankrd11 A T 8: 122,894,304 C915* probably null Het
Ankrd44 A T 1: 54,735,050 I398K probably damaging Het
Ankrd44 T C 1: 54,762,347 T274A probably damaging Het
Arhgef2 A G 3: 88,642,976 T663A probably benign Het
BC048403 T C 10: 121,740,147 probably benign Het
Cdc37 G A 9: 21,143,213 R39C probably damaging Het
Cnnm1 A G 19: 43,465,157 N537S possibly damaging Het
Cop1 T A 1: 159,250,073 D159E probably benign Het
Crtac1 C T 19: 42,413,951 V73I probably benign Het
Cryz T A 3: 154,606,518 V84E probably damaging Het
Ctnnd2 C T 15: 30,669,543 L433F probably benign Het
Ctsq C A 13: 61,037,060 D271Y probably benign Het
Cyp3a25 A C 5: 145,994,863 probably null Het
Dmbt1 G C 7: 131,054,067 W412C probably benign Het
Eif4e1b G A 13: 54,786,716 V131I possibly damaging Het
Epha1 A G 6: 42,364,634 V494A possibly damaging Het
Fbxl4 T C 4: 22,433,641 S593P probably damaging Het
Fbxo41 G A 6: 85,479,901 P429S probably benign Het
Fgfr3 G A 5: 33,730,003 C204Y probably damaging Het
Gbf1 T C 19: 46,284,422 V1665A possibly damaging Het
Htt T A 5: 34,905,397 V2825E probably damaging Het
Irs1 A T 1: 82,289,925 V190E probably damaging Het
Klk1 T C 7: 44,228,737 probably null Het
Kmt2d T C 15: 98,850,024 probably benign Het
Meox1 T C 11: 101,879,343 E186G probably damaging Het
Micu2 G A 14: 57,971,744 R86W probably damaging Het
Mrgprb1 A T 7: 48,447,684 I160K probably damaging Het
Nckap1l T A 15: 103,475,658 M561K possibly damaging Het
Olfr1199 A T 2: 88,756,405 I90N probably damaging Het
Olfr605 A T 7: 103,442,428 S232T probably damaging Het
Olfr689 A T 7: 105,314,006 M1L probably benign Het
Otoa T A 7: 121,121,977 L405H probably damaging Het
Phyhip A T 14: 70,466,874 M178L probably benign Het
Pkd1l3 A T 8: 109,655,520 N1630I probably damaging Het
Plek2 T A 12: 78,894,109 T247S probably benign Het
Rhbdl3 T C 11: 80,337,583 V293A probably damaging Het
Rock2 T A 12: 16,942,809 F193Y probably damaging Het
Scn3a C T 2: 65,460,713 M1896I probably benign Het
Snrnp200 T C 2: 127,226,013 V810A probably damaging Het
Taar4 G A 10: 23,960,741 S83N probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tec T A 5: 72,768,744 I322F possibly damaging Het
Teddm2 T C 1: 153,850,400 I190V probably benign Het
Tmem117 A G 15: 95,094,884 E475G probably damaging Het
Trip10 T A 17: 57,262,460 Y495N probably damaging Het
Ush2a T C 1: 188,906,498 V4035A possibly damaging Het
Utrn C T 10: 12,682,318 V1466M possibly damaging Het
Vasp A G 7: 19,257,891 probably benign Het
Vmn1r89 A T 7: 13,219,930 M130L possibly damaging Het
Vmn2r2 A T 3: 64,126,615 D495E possibly damaging Het
Zfp213 A G 17: 23,561,186 V120A possibly damaging Het
Other mutations in Btbd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Btbd16 APN 7 130788822 missense probably damaging 1.00
IGL01020:Btbd16 APN 7 130824361 missense probably damaging 1.00
IGL01098:Btbd16 APN 7 130823245 missense probably damaging 1.00
IGL01412:Btbd16 APN 7 130805819 critical splice acceptor site probably null
1mM(1):Btbd16 UTSW 7 130821491 missense possibly damaging 0.86
R0063:Btbd16 UTSW 7 130823166 missense probably benign 0.25
R0063:Btbd16 UTSW 7 130823166 missense probably benign 0.25
R0147:Btbd16 UTSW 7 130779594 missense probably damaging 1.00
R0436:Btbd16 UTSW 7 130786053 missense probably benign 0.10
R0715:Btbd16 UTSW 7 130788827 missense probably damaging 1.00
R2127:Btbd16 UTSW 7 130784308 missense probably benign 0.17
R2411:Btbd16 UTSW 7 130790224 missense probably damaging 1.00
R3798:Btbd16 UTSW 7 130777140 missense probably benign 0.43
R5595:Btbd16 UTSW 7 130823304 missense probably damaging 1.00
R5839:Btbd16 UTSW 7 130815808 critical splice donor site probably null
R5933:Btbd16 UTSW 7 130784281 missense probably damaging 0.99
R6029:Btbd16 UTSW 7 130819072 missense probably benign 0.17
R7255:Btbd16 UTSW 7 130785992 missense probably benign 0.04
R7355:Btbd16 UTSW 7 130821443 missense probably benign 0.01
R7405:Btbd16 UTSW 7 130805856 missense probably benign 0.08
R7527:Btbd16 UTSW 7 130820472 missense probably damaging 1.00
R7980:Btbd16 UTSW 7 130824367 missense probably damaging 1.00
R8151:Btbd16 UTSW 7 130797095 missense probably damaging 1.00
R8429:Btbd16 UTSW 7 130795337 missense probably benign
X0064:Btbd16 UTSW 7 130823170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGCTCTTGTCACCCTAG -3'
(R):5'- TTTGGCATCATTTGGAACCG -3'

Sequencing Primer
(F):5'- CTAGTCCTGGGGCTACATGG -3'
(R):5'- TGGAACCGTTGTAATCCTAAGG -3'
Posted On2016-10-26