Incidental Mutation 'R5595:4931440F15Rik'
ID437785
Institutional Source Beutler Lab
Gene Symbol 4931440F15Rik
Ensembl Gene ENSMUSG00000078157
Gene NameRIKEN cDNA 4931440F15 gene
Synonyms
MMRRC Submission 043147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5595 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29822395-29825668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29824288 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 390 (N390D)
Ref Sequence ENSEMBL: ENSMUSP00000100568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000104962]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000104962
AA Change: N390D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000100568
Gene: ENSMUSG00000078157
AA Change: N390D

DomainStartEndE-ValueType
ANK 19 50 1.53e3 SMART
ANK 57 87 1.7e-3 SMART
ANK 99 128 3.6e-2 SMART
ANK 132 162 3.31e-1 SMART
ANK 166 195 8.19e-6 SMART
ANK 199 228 7.83e-3 SMART
ANK 231 260 1.8e-2 SMART
low complexity region 297 306 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
ANK 536 578 8.39e-3 SMART
ANK 582 611 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109452
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,864,279 F991S probably benign Het
4931406B18Rik A G 7: 43,497,872 I218T possibly damaging Het
9930111J21Rik2 C T 11: 49,019,711 A632T possibly damaging Het
Akt1 A T 12: 112,658,616 L166Q probably null Het
Alpk2 A T 18: 65,266,248 D2086E probably damaging Het
Ankrd11 A T 8: 122,894,304 C915* probably null Het
Ankrd44 A T 1: 54,735,050 I398K probably damaging Het
Ankrd44 T C 1: 54,762,347 T274A probably damaging Het
Arhgef2 A G 3: 88,642,976 T663A probably benign Het
BC048403 T C 10: 121,740,147 probably benign Het
Btbd16 G A 7: 130,823,303 M471I possibly damaging Het
Btbd16 C A 7: 130,823,304 Q472K probably damaging Het
Cdc37 G A 9: 21,143,213 R39C probably damaging Het
Cnnm1 A G 19: 43,465,157 N537S possibly damaging Het
Cop1 T A 1: 159,250,073 D159E probably benign Het
Crtac1 C T 19: 42,413,951 V73I probably benign Het
Cryz T A 3: 154,606,518 V84E probably damaging Het
Ctnnd2 C T 15: 30,669,543 L433F probably benign Het
Ctsq C A 13: 61,037,060 D271Y probably benign Het
Cyp3a25 A C 5: 145,994,863 probably null Het
Dmbt1 G C 7: 131,054,067 W412C probably benign Het
Eif4e1b G A 13: 54,786,716 V131I possibly damaging Het
Epha1 A G 6: 42,364,634 V494A possibly damaging Het
Fbxl4 T C 4: 22,433,641 S593P probably damaging Het
Fbxo41 G A 6: 85,479,901 P429S probably benign Het
Fgfr3 G A 5: 33,730,003 C204Y probably damaging Het
Gbf1 T C 19: 46,284,422 V1665A possibly damaging Het
Htt T A 5: 34,905,397 V2825E probably damaging Het
Irs1 A T 1: 82,289,925 V190E probably damaging Het
Klk1 T C 7: 44,228,737 probably null Het
Kmt2d T C 15: 98,850,024 probably benign Het
Meox1 T C 11: 101,879,343 E186G probably damaging Het
Micu2 G A 14: 57,971,744 R86W probably damaging Het
Mrgprb1 A T 7: 48,447,684 I160K probably damaging Het
Nckap1l T A 15: 103,475,658 M561K possibly damaging Het
Olfr1199 A T 2: 88,756,405 I90N probably damaging Het
Olfr605 A T 7: 103,442,428 S232T probably damaging Het
Olfr689 A T 7: 105,314,006 M1L probably benign Het
Otoa T A 7: 121,121,977 L405H probably damaging Het
Phyhip A T 14: 70,466,874 M178L probably benign Het
Pkd1l3 A T 8: 109,655,520 N1630I probably damaging Het
Plek2 T A 12: 78,894,109 T247S probably benign Het
Rhbdl3 T C 11: 80,337,583 V293A probably damaging Het
Rock2 T A 12: 16,942,809 F193Y probably damaging Het
Scn3a C T 2: 65,460,713 M1896I probably benign Het
Snrnp200 T C 2: 127,226,013 V810A probably damaging Het
Taar4 G A 10: 23,960,741 S83N probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tec T A 5: 72,768,744 I322F possibly damaging Het
Teddm2 T C 1: 153,850,400 I190V probably benign Het
Tmem117 A G 15: 95,094,884 E475G probably damaging Het
Trip10 T A 17: 57,262,460 Y495N probably damaging Het
Ush2a T C 1: 188,906,498 V4035A possibly damaging Het
Utrn C T 10: 12,682,318 V1466M possibly damaging Het
Vasp A G 7: 19,257,891 probably benign Het
Vmn1r89 A T 7: 13,219,930 M130L possibly damaging Het
Vmn2r2 A T 3: 64,126,615 D495E possibly damaging Het
Zfp213 A G 17: 23,561,186 V120A possibly damaging Het
Other mutations in 4931440F15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:4931440F15Rik APN 11 29824755 missense probably damaging 1.00
IGL01560:4931440F15Rik APN 11 29824643 nonsense probably null
IGL02160:4931440F15Rik APN 11 29823593 nonsense probably null
IGL03058:4931440F15Rik APN 11 29824656 missense probably benign 0.01
IGL03107:4931440F15Rik APN 11 29824360 missense probably damaging 1.00
R0504:4931440F15Rik UTSW 11 29824990 missense probably damaging 1.00
R0615:4931440F15Rik UTSW 11 29824515 missense probably damaging 1.00
R1167:4931440F15Rik UTSW 11 29823567 missense probably damaging 1.00
R1329:4931440F15Rik UTSW 11 29823553 missense probably benign 0.01
R1525:4931440F15Rik UTSW 11 29823994 missense probably benign 0.11
R1745:4931440F15Rik UTSW 11 29824723 missense probably benign
R1917:4931440F15Rik UTSW 11 29824039 missense probably benign 0.00
R1918:4931440F15Rik UTSW 11 29824039 missense probably benign 0.00
R2338:4931440F15Rik UTSW 11 29823718 missense probably benign 0.01
R4359:4931440F15Rik UTSW 11 29824669 missense probably benign 0.12
R4757:4931440F15Rik UTSW 11 29825454 start codon destroyed probably null 1.00
R4859:4931440F15Rik UTSW 11 29825178 missense probably damaging 1.00
R7084:4931440F15Rik UTSW 11 29825009 missense probably damaging 0.99
R7447:4931440F15Rik UTSW 11 29824122 missense probably benign
Z1088:4931440F15Rik UTSW 11 29825007 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTGTGCGGAGTCATCC -3'
(R):5'- TCTGGCCTATGACTATTCCAGGG -3'

Sequencing Primer
(F):5'- TTGCTGAGCACACCTATGAG -3'
(R):5'- CCTATGACTATTCCAGGGAGGTGAC -3'
Posted On2016-10-26