Mutagenetix > Incidental Mutations

Incidental Mutation 'R5595:Rock2'

437790

Institutional Source

Beutler Lab

Gene Symbol

Rock2

Ensembl Gene

ENSMUSG00000020580

Gene Name

Rho-associated coiled-coil containing protein kinase 2

Synonyms

B230113H15Rik, ROKalpha, Rho-kinase, Rock-II, Rock2m

MMRRC Submission

043147-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.847) question?

Stock #

R5595 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16894895-16987823 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 16942809 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 193 (F193Y)

Ref Sequence

ENSEMBL: ENSMUSP00000152813 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020904] [ENSMUST00000220688]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000020904
AA Change: F193Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580
AA Change: F193Y

Domain	Start	End	E-Value	Type
low complexity region	46	58	N/A	INTRINSIC
S_TKc	92	354	9.2e-96	SMART
S_TK_X	357	417	3.24e-13	SMART
PDB:3O0Z\|D	552	717	4e-46	PDB
low complexity region	723	743	N/A	INTRINSIC
low complexity region	882	909	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
Pfam:Rho_Binding	978	1046	4.7e-28	PFAM
coiled coil region	1054	1126	N/A	INTRINSIC
PH	1151	1351	2.88e-5	SMART
C1	1261	1315	2.21e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082686

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220542

Predicted Effect

probably damaging
Transcript: ENSMUST00000220688
AA Change: F193Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this genes tend to die before birth; those that survive are small. Hemorrhaging occurs in the placenta, at the tips of hind limb buds and occasionally the tail. Subsequent development is normal and the size deficit is made up. They are fertile as adults. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,864,279	F991S	probably benign	Het
4931406B18Rik	A	G	7: 43,497,872	I218T	possibly damaging	Het
4931440F15Rik	T	C	11: 29,824,288	N390D	probably benign	Het
9930111J21Rik2	C	T	11: 49,019,711	A632T	possibly damaging	Het
Akt1	A	T	12: 112,658,616	L166Q	probably null	Het
Alpk2	A	T	18: 65,266,248	D2086E	probably damaging	Het
Ankrd11	A	T	8: 122,894,304	C915*	probably null	Het
Ankrd44	A	T	1: 54,735,050	I398K	probably damaging	Het
Ankrd44	T	C	1: 54,762,347	T274A	probably damaging	Het
Arhgef2	A	G	3: 88,642,976	T663A	probably benign	Het
BC048403	T	C	10: 121,740,147		probably benign	Het
Btbd16	G	A	7: 130,823,303	M471I	possibly damaging	Het
Btbd16	C	A	7: 130,823,304	Q472K	probably damaging	Het
Cdc37	G	A	9: 21,143,213	R39C	probably damaging	Het
Cnnm1	A	G	19: 43,465,157	N537S	possibly damaging	Het
Cop1	T	A	1: 159,250,073	D159E	probably benign	Het
Crtac1	C	T	19: 42,413,951	V73I	probably benign	Het
Cryz	T	A	3: 154,606,518	V84E	probably damaging	Het
Ctnnd2	C	T	15: 30,669,543	L433F	probably benign	Het
Ctsq	C	A	13: 61,037,060	D271Y	probably benign	Het
Cyp3a25	A	C	5: 145,994,863		probably null	Het
Dmbt1	G	C	7: 131,054,067	W412C	probably benign	Het
Eif4e1b	G	A	13: 54,786,716	V131I	possibly damaging	Het
Epha1	A	G	6: 42,364,634	V494A	possibly damaging	Het
Fbxl4	T	C	4: 22,433,641	S593P	probably damaging	Het
Fbxo41	G	A	6: 85,479,901	P429S	probably benign	Het
Fgfr3	G	A	5: 33,730,003	C204Y	probably damaging	Het
Gbf1	T	C	19: 46,284,422	V1665A	possibly damaging	Het
Htt	T	A	5: 34,905,397	V2825E	probably damaging	Het
Irs1	A	T	1: 82,289,925	V190E	probably damaging	Het
Klk1	T	C	7: 44,228,737		probably null	Het
Kmt2d	T	C	15: 98,850,024		probably benign	Het
Meox1	T	C	11: 101,879,343	E186G	probably damaging	Het
Micu2	G	A	14: 57,971,744	R86W	probably damaging	Het
Mrgprb1	A	T	7: 48,447,684	I160K	probably damaging	Het
Nckap1l	T	A	15: 103,475,658	M561K	possibly damaging	Het
Olfr1199	A	T	2: 88,756,405	I90N	probably damaging	Het
Olfr605	A	T	7: 103,442,428	S232T	probably damaging	Het
Olfr689	A	T	7: 105,314,006	M1L	probably benign	Het
Otoa	T	A	7: 121,121,977	L405H	probably damaging	Het
Phyhip	A	T	14: 70,466,874	M178L	probably benign	Het
Pkd1l3	A	T	8: 109,655,520	N1630I	probably damaging	Het
Plek2	T	A	12: 78,894,109	T247S	probably benign	Het
Rhbdl3	T	C	11: 80,337,583	V293A	probably damaging	Het
Scn3a	C	T	2: 65,460,713	M1896I	probably benign	Het
Snrnp200	T	C	2: 127,226,013	V810A	probably damaging	Het
Taar4	G	A	10: 23,960,741	S83N	probably damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Tec	T	A	5: 72,768,744	I322F	possibly damaging	Het
Teddm2	T	C	1: 153,850,400	I190V	probably benign	Het
Tmem117	A	G	15: 95,094,884	E475G	probably damaging	Het
Trip10	T	A	17: 57,262,460	Y495N	probably damaging	Het
Ush2a	T	C	1: 188,906,498	V4035A	possibly damaging	Het
Utrn	C	T	10: 12,682,318	V1466M	possibly damaging	Het
Vasp	A	G	7: 19,257,891		probably benign	Het
Vmn1r89	A	T	7: 13,219,930	M130L	possibly damaging	Het
Vmn2r2	A	T	3: 64,126,615	D495E	possibly damaging	Het
Zfp213	A	G	17: 23,561,186	V120A	possibly damaging	Het

Other mutations in Rock2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Rock2	APN	12	16978055	missense	probably benign	0.11
IGL01565:Rock2	APN	12	16953317	missense	possibly damaging	0.62
IGL01637:Rock2	APN	12	16965171	missense	probably benign
IGL02164:Rock2	APN	12	16965529	missense	probably damaging	1.00
IGL02249:Rock2	APN	12	16971041	unclassified	probably benign
IGL02490:Rock2	APN	12	16948563	missense	probably damaging	1.00
IGL02815:Rock2	APN	12	16966701	splice site	probably benign
IGL02979:Rock2	APN	12	16977940	missense	probably benign	0.00
IGL03095:Rock2	APN	12	16953340	missense	probably benign	0.00
IGL03198:Rock2	APN	12	16975507	missense	probably benign	0.27
R0087:Rock2	UTSW	12	16928966	missense	probably benign	0.20
R0189:Rock2	UTSW	12	16959516	splice site	probably benign
R0282:Rock2	UTSW	12	16977886	splice site	probably benign
R0497:Rock2	UTSW	12	16954953	missense	probably benign
R1210:Rock2	UTSW	12	16965469	missense	probably damaging	0.96
R1347:Rock2	UTSW	12	16977624	missense	possibly damaging	0.70
R1347:Rock2	UTSW	12	16977624	missense	possibly damaging	0.70
R1616:Rock2	UTSW	12	16972985	missense	probably benign	0.03
R1672:Rock2	UTSW	12	16965652	missense	probably benign	0.03
R1815:Rock2	UTSW	12	16972726	missense	probably benign	0.01
R1840:Rock2	UTSW	12	16928989	missense	probably benign
R2349:Rock2	UTSW	12	16977615	missense	probably benign	0.07
R3149:Rock2	UTSW	12	16965091	missense	probably damaging	1.00
R3979:Rock2	UTSW	12	16972736	missense	probably damaging	1.00
R4030:Rock2	UTSW	12	16975479	missense	probably damaging	1.00
R4470:Rock2	UTSW	12	16971275	nonsense	probably null
R4492:Rock2	UTSW	12	16977683	missense	probably damaging	1.00
R4519:Rock2	UTSW	12	16977737	missense	probably damaging	1.00
R4776:Rock2	UTSW	12	16977740	missense	probably damaging	1.00
R4794:Rock2	UTSW	12	16940407	missense	probably damaging	1.00
R4908:Rock2	UTSW	12	16959491	missense	probably benign	0.00
R5363:Rock2	UTSW	12	16965654	critical splice donor site	probably null
R5574:Rock2	UTSW	12	16961641	missense	possibly damaging	0.55
R6158:Rock2	UTSW	12	16954918	missense	probably benign
R6728:Rock2	UTSW	12	16961736	missense	probably benign	0.00
R6828:Rock2	UTSW	12	16942959	splice site	probably null
R7019:Rock2	UTSW	12	16977740	missense	probably damaging	1.00
R7181:Rock2	UTSW	12	16973143	missense	probably benign	0.00
R7236:Rock2	UTSW	12	16929002	missense	probably damaging	1.00
R7362:Rock2	UTSW	12	16958421	missense	probably damaging	1.00
R7593:Rock2	UTSW	12	16958240	missense	probably benign	0.00
R7743:Rock2	UTSW	12	16976047	missense	probably damaging	1.00
R7782:Rock2	UTSW	12	16971110	missense	probably benign	0.17
R7935:Rock2	UTSW	12	16948557	missense	probably damaging	1.00
R8012:Rock2	UTSW	12	16942742	missense	probably damaging	1.00
R8339:Rock2	UTSW	12	16974860	missense	probably damaging	0.98
R8809:Rock2	UTSW	12	16965654	critical splice donor site	probably benign
R8918:Rock2	UTSW	12	16940421	nonsense	probably null
R9198:Rock2	UTSW	12	16965556	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCATTAAACAGGCTTGATCCAG -3'
(R):5'- CTCAAAATTGCAGAGTCCTGATTTG -3'

Sequencing Primer
(F):5'- GGCTTGATCCAGAAGTAAAGGATTTC -3'
(R):5'- GGTGACCTGAGCATATCTCTAGAAC -3'

Posted On

2016-10-26