Incidental Mutation 'R5595:Akt1'
ID437792
Institutional Source Beutler Lab
Gene Symbol Akt1
Ensembl Gene ENSMUSG00000001729
Gene Namethymoma viral proto-oncogene 1
SynonymsPKBalpha, PKB/Akt, Akt, PKB
MMRRC Submission 043147-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R5595 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112653821-112674884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112658616 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 166 (L166Q)
Ref Sequence ENSEMBL: ENSMUSP00000123689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001780] [ENSMUST00000128300] [ENSMUST00000130342] [ENSMUST00000144550]
Predicted Effect probably null
Transcript: ENSMUST00000001780
AA Change: L166Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001780
Gene: ENSMUSG00000001729
AA Change: L166Q

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
S_TKc 150 408 1.56e-107 SMART
S_TK_X 409 476 1.44e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127902
Predicted Effect probably null
Transcript: ENSMUST00000128300
AA Change: L166Q

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122222
Gene: ENSMUSG00000001729
AA Change: L166Q

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 278 1e-31 PFAM
Pfam:Pkinase_Tyr 150 278 3.8e-13 PFAM
Pfam:Pkinase_Tyr 276 350 8.7e-6 PFAM
Pfam:Pkinase 277 365 5e-17 PFAM
S_TK_X 366 433 1.44e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000130342
SMART Domains Protein: ENSMUSP00000118190
Gene: ENSMUSG00000001729

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139388
Predicted Effect probably null
Transcript: ENSMUST00000144550
AA Change: L166Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123689
Gene: ENSMUSG00000001729
AA Change: L166Q

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 202 2.6e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184981
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the founding member of the Akt serine-threonine protein kinase gene family that also includes Akt2 and Akt3. This kinase is a major downstream effector of the phosphatidylinositol 3-kinase (PI3K) pathway that mediates the effects of various growth factors such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), insulin and insulin-like growth factor I (IGF-I). It is activated through recruitment to cellular membranes by PI3K lipid products and by phosphorylation by 3-phosphoinositide dependent kinase-1. It then further phosphorylates different downstream proteins in response to various extracellular signals and thus plays a pivotal role in mediating a variety of cellular processes, such as glucose metabolism, glycogen biosynthesis, protein synthesis and turn over, inflammatory response, cell survival (anti-apoptosis) and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mutant homozygotes are smaller than sibs due to retarded prenatal and postnatal growth and exhibit increased apoptosis and decreased lifespan with genotoxic stress. Mice are fertile, but males have attenuated spermatogenesis and abnormal testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,864,279 F991S probably benign Het
4931406B18Rik A G 7: 43,497,872 I218T possibly damaging Het
4931440F15Rik T C 11: 29,824,288 N390D probably benign Het
9930111J21Rik2 C T 11: 49,019,711 A632T possibly damaging Het
Alpk2 A T 18: 65,266,248 D2086E probably damaging Het
Ankrd11 A T 8: 122,894,304 C915* probably null Het
Ankrd44 A T 1: 54,735,050 I398K probably damaging Het
Ankrd44 T C 1: 54,762,347 T274A probably damaging Het
Arhgef2 A G 3: 88,642,976 T663A probably benign Het
BC048403 T C 10: 121,740,147 probably benign Het
Btbd16 G A 7: 130,823,303 M471I possibly damaging Het
Btbd16 C A 7: 130,823,304 Q472K probably damaging Het
Cdc37 G A 9: 21,143,213 R39C probably damaging Het
Cnnm1 A G 19: 43,465,157 N537S possibly damaging Het
Cop1 T A 1: 159,250,073 D159E probably benign Het
Crtac1 C T 19: 42,413,951 V73I probably benign Het
Cryz T A 3: 154,606,518 V84E probably damaging Het
Ctnnd2 C T 15: 30,669,543 L433F probably benign Het
Ctsq C A 13: 61,037,060 D271Y probably benign Het
Cyp3a25 A C 5: 145,994,863 probably null Het
Dmbt1 G C 7: 131,054,067 W412C probably benign Het
Eif4e1b G A 13: 54,786,716 V131I possibly damaging Het
Epha1 A G 6: 42,364,634 V494A possibly damaging Het
Fbxl4 T C 4: 22,433,641 S593P probably damaging Het
Fbxo41 G A 6: 85,479,901 P429S probably benign Het
Fgfr3 G A 5: 33,730,003 C204Y probably damaging Het
Gbf1 T C 19: 46,284,422 V1665A possibly damaging Het
Htt T A 5: 34,905,397 V2825E probably damaging Het
Irs1 A T 1: 82,289,925 V190E probably damaging Het
Klk1 T C 7: 44,228,737 probably null Het
Kmt2d T C 15: 98,850,024 probably benign Het
Meox1 T C 11: 101,879,343 E186G probably damaging Het
Micu2 G A 14: 57,971,744 R86W probably damaging Het
Mrgprb1 A T 7: 48,447,684 I160K probably damaging Het
Nckap1l T A 15: 103,475,658 M561K possibly damaging Het
Olfr1199 A T 2: 88,756,405 I90N probably damaging Het
Olfr605 A T 7: 103,442,428 S232T probably damaging Het
Olfr689 A T 7: 105,314,006 M1L probably benign Het
Otoa T A 7: 121,121,977 L405H probably damaging Het
Phyhip A T 14: 70,466,874 M178L probably benign Het
Pkd1l3 A T 8: 109,655,520 N1630I probably damaging Het
Plek2 T A 12: 78,894,109 T247S probably benign Het
Rhbdl3 T C 11: 80,337,583 V293A probably damaging Het
Rock2 T A 12: 16,942,809 F193Y probably damaging Het
Scn3a C T 2: 65,460,713 M1896I probably benign Het
Snrnp200 T C 2: 127,226,013 V810A probably damaging Het
Taar4 G A 10: 23,960,741 S83N probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tec T A 5: 72,768,744 I322F possibly damaging Het
Teddm2 T C 1: 153,850,400 I190V probably benign Het
Tmem117 A G 15: 95,094,884 E475G probably damaging Het
Trip10 T A 17: 57,262,460 Y495N probably damaging Het
Ush2a T C 1: 188,906,498 V4035A possibly damaging Het
Utrn C T 10: 12,682,318 V1466M possibly damaging Het
Vasp A G 7: 19,257,891 probably benign Het
Vmn1r89 A T 7: 13,219,930 M130L possibly damaging Het
Vmn2r2 A T 3: 64,126,615 D495E possibly damaging Het
Zfp213 A G 17: 23,561,186 V120A possibly damaging Het
Other mutations in Akt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Akt1 APN 12 112657671 missense probably damaging 1.00
IGL01779:Akt1 APN 12 112657169 missense probably damaging 1.00
IGL01886:Akt1 APN 12 112659158 missense probably benign 0.16
IGL02506:Akt1 APN 12 112659280 splice site probably benign
IGL02851:Akt1 APN 12 112657084 missense probably damaging 1.00
R0211:Akt1 UTSW 12 112655142 missense probably damaging 0.98
R0211:Akt1 UTSW 12 112655142 missense probably damaging 0.98
R1891:Akt1 UTSW 12 112659575 missense probably damaging 1.00
R1988:Akt1 UTSW 12 112655151 missense probably benign 0.02
R2018:Akt1 UTSW 12 112659625 missense probably damaging 0.99
R2019:Akt1 UTSW 12 112659625 missense probably damaging 0.99
R2023:Akt1 UTSW 12 112659637 missense probably benign 0.33
R3873:Akt1 UTSW 12 112656533 missense probably benign
R4446:Akt1 UTSW 12 112659133 missense probably benign 0.05
R4832:Akt1 UTSW 12 112657087 missense probably damaging 1.00
R5457:Akt1 UTSW 12 112657091 missense probably damaging 0.96
R5723:Akt1 UTSW 12 112657270 missense probably damaging 1.00
R5736:Akt1 UTSW 12 112656850 missense probably benign 0.12
R6058:Akt1 UTSW 12 112662200 missense probably damaging 0.99
R6473:Akt1 UTSW 12 112662260 missense probably damaging 1.00
R7045:Akt1 UTSW 12 112662301 nonsense probably null
R7129:Akt1 UTSW 12 112659649 missense probably benign 0.22
R7311:Akt1 UTSW 12 112657153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCCACTGCTTACCGTAAG -3'
(R):5'- ACTCTGGACACTGTCAAGCC -3'

Sequencing Primer
(F):5'- ATGCCTAGAGTTCTGCAGGACAC -3'
(R):5'- TGGACACTGTCAAGCCGAAGG -3'
Posted On2016-10-26