Incidental Mutation 'R5595:Tmem117'
ID437798
Institutional Source Beutler Lab
Gene Symbol Tmem117
Ensembl Gene ENSMUSG00000063296
Gene Nametransmembrane protein 117
Synonyms
MMRRC Submission 043147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R5595 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94629232-95096098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95094884 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 475 (E475G)
Ref Sequence ENSEMBL: ENSMUSP00000079038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080141] [ENSMUST00000229933]
Predicted Effect probably damaging
Transcript: ENSMUST00000080141
AA Change: E475G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079038
Gene: ENSMUSG00000063296
AA Change: E475G

DomainStartEndE-ValueType
Pfam:TMEM117 4 416 1.1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189291
Predicted Effect probably benign
Transcript: ENSMUST00000229933
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,864,279 F991S probably benign Het
4931406B18Rik A G 7: 43,497,872 I218T possibly damaging Het
4931440F15Rik T C 11: 29,824,288 N390D probably benign Het
9930111J21Rik2 C T 11: 49,019,711 A632T possibly damaging Het
Akt1 A T 12: 112,658,616 L166Q probably null Het
Alpk2 A T 18: 65,266,248 D2086E probably damaging Het
Ankrd11 A T 8: 122,894,304 C915* probably null Het
Ankrd44 A T 1: 54,735,050 I398K probably damaging Het
Ankrd44 T C 1: 54,762,347 T274A probably damaging Het
Arhgef2 A G 3: 88,642,976 T663A probably benign Het
BC048403 T C 10: 121,740,147 probably benign Het
Btbd16 G A 7: 130,823,303 M471I possibly damaging Het
Btbd16 C A 7: 130,823,304 Q472K probably damaging Het
Cdc37 G A 9: 21,143,213 R39C probably damaging Het
Cnnm1 A G 19: 43,465,157 N537S possibly damaging Het
Cop1 T A 1: 159,250,073 D159E probably benign Het
Crtac1 C T 19: 42,413,951 V73I probably benign Het
Cryz T A 3: 154,606,518 V84E probably damaging Het
Ctnnd2 C T 15: 30,669,543 L433F probably benign Het
Ctsq C A 13: 61,037,060 D271Y probably benign Het
Cyp3a25 A C 5: 145,994,863 probably null Het
Dmbt1 G C 7: 131,054,067 W412C probably benign Het
Eif4e1b G A 13: 54,786,716 V131I possibly damaging Het
Epha1 A G 6: 42,364,634 V494A possibly damaging Het
Fbxl4 T C 4: 22,433,641 S593P probably damaging Het
Fbxo41 G A 6: 85,479,901 P429S probably benign Het
Fgfr3 G A 5: 33,730,003 C204Y probably damaging Het
Gbf1 T C 19: 46,284,422 V1665A possibly damaging Het
Htt T A 5: 34,905,397 V2825E probably damaging Het
Irs1 A T 1: 82,289,925 V190E probably damaging Het
Klk1 T C 7: 44,228,737 probably null Het
Kmt2d T C 15: 98,850,024 probably benign Het
Meox1 T C 11: 101,879,343 E186G probably damaging Het
Micu2 G A 14: 57,971,744 R86W probably damaging Het
Mrgprb1 A T 7: 48,447,684 I160K probably damaging Het
Nckap1l T A 15: 103,475,658 M561K possibly damaging Het
Olfr1199 A T 2: 88,756,405 I90N probably damaging Het
Olfr605 A T 7: 103,442,428 S232T probably damaging Het
Olfr689 A T 7: 105,314,006 M1L probably benign Het
Otoa T A 7: 121,121,977 L405H probably damaging Het
Phyhip A T 14: 70,466,874 M178L probably benign Het
Pkd1l3 A T 8: 109,655,520 N1630I probably damaging Het
Plek2 T A 12: 78,894,109 T247S probably benign Het
Rhbdl3 T C 11: 80,337,583 V293A probably damaging Het
Rock2 T A 12: 16,942,809 F193Y probably damaging Het
Scn3a C T 2: 65,460,713 M1896I probably benign Het
Snrnp200 T C 2: 127,226,013 V810A probably damaging Het
Taar4 G A 10: 23,960,741 S83N probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tec T A 5: 72,768,744 I322F possibly damaging Het
Teddm2 T C 1: 153,850,400 I190V probably benign Het
Trip10 T A 17: 57,262,460 Y495N probably damaging Het
Ush2a T C 1: 188,906,498 V4035A possibly damaging Het
Utrn C T 10: 12,682,318 V1466M possibly damaging Het
Vasp A G 7: 19,257,891 probably benign Het
Vmn1r89 A T 7: 13,219,930 M130L possibly damaging Het
Vmn2r2 A T 3: 64,126,615 D495E possibly damaging Het
Zfp213 A G 17: 23,561,186 V120A possibly damaging Het
Other mutations in Tmem117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Tmem117 APN 15 95094664 missense probably benign
IGL02342:Tmem117 APN 15 95011450 missense possibly damaging 0.76
IGL02418:Tmem117 APN 15 94931884 missense probably benign 0.10
IGL02651:Tmem117 APN 15 95094561 missense probably damaging 1.00
IGL02740:Tmem117 APN 15 94714982 missense probably benign 0.00
IGL02819:Tmem117 APN 15 94879372 splice site probably benign
IGL02881:Tmem117 APN 15 94879425 missense probably damaging 1.00
IGL02887:Tmem117 APN 15 95094775 missense probably damaging 1.00
IGL03371:Tmem117 APN 15 95011393 missense probably damaging 1.00
R0464:Tmem117 UTSW 15 94714919 missense probably damaging 0.98
R0539:Tmem117 UTSW 15 94714912 missense possibly damaging 0.63
R1029:Tmem117 UTSW 15 95011336 missense probably benign
R1424:Tmem117 UTSW 15 94931808 missense probably benign 0.35
R1439:Tmem117 UTSW 15 95094597 missense probably benign
R1498:Tmem117 UTSW 15 94638361 missense probably damaging 1.00
R1604:Tmem117 UTSW 15 95094544 missense probably damaging 1.00
R1746:Tmem117 UTSW 15 94931833 missense possibly damaging 0.55
R1829:Tmem117 UTSW 15 95094551 missense probably damaging 1.00
R3434:Tmem117 UTSW 15 95094692 missense probably damaging 0.98
R3435:Tmem117 UTSW 15 95094692 missense probably damaging 0.98
R4560:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4561:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4562:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4563:Tmem117 UTSW 15 94638154 missense possibly damaging 0.95
R4777:Tmem117 UTSW 15 95094450 nonsense probably null
R4854:Tmem117 UTSW 15 95094688 missense probably damaging 0.97
R5051:Tmem117 UTSW 15 94714913 missense probably damaging 0.96
R5472:Tmem117 UTSW 15 95094513 missense possibly damaging 0.91
R5485:Tmem117 UTSW 15 95094830 missense probably benign 0.00
R5488:Tmem117 UTSW 15 95094817 frame shift probably null
R5648:Tmem117 UTSW 15 95094772 missense possibly damaging 0.88
R5892:Tmem117 UTSW 15 94638139 missense probably damaging 0.99
R5901:Tmem117 UTSW 15 94714958 missense probably benign 0.08
R6334:Tmem117 UTSW 15 95011443 missense probably benign 0.01
R7216:Tmem117 UTSW 15 94714912 missense possibly damaging 0.91
R7266:Tmem117 UTSW 15 94931803 missense possibly damaging 0.82
R7414:Tmem117 UTSW 15 94714895 missense probably damaging 1.00
R7445:Tmem117 UTSW 15 94714918 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCCTAGATGTCAAGTGTCTGG -3'
(R):5'- GCATGTTGAGCACCGTTGTG -3'

Sequencing Primer
(F):5'- CTTTGGACGGTTTCTGAAAAATGAGC -3'
(R):5'- AGCACCGTTGTGGCATAG -3'
Posted On2016-10-26