Incidental Mutation 'R5595:4930562C15Rik'
ID437801
Institutional Source Beutler Lab
Gene Symbol 4930562C15Rik
Ensembl Gene ENSMUSG00000022518
Gene NameRIKEN cDNA 4930562C15 gene
Synonyms
MMRRC Submission 043147-MU
Accession Numbers

Ncbi RefSeq: NM_030192.1; MGI:1926059

Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5595 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4835416-4867686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4864279 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 991 (F991S)
Ref Sequence ENSEMBL: ENSMUSP00000097784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100211] [ENSMUST00000171105] [ENSMUST00000176394] [ENSMUST00000176982]
Predicted Effect probably benign
Transcript: ENSMUST00000100211
AA Change: F991S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097784
Gene: ENSMUSG00000022518
AA Change: F991S

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
coiled coil region 181 211 N/A INTRINSIC
internal_repeat_1 289 315 2.54e-5 PROSPERO
internal_repeat_1 314 341 2.54e-5 PROSPERO
low complexity region 360 377 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
low complexity region 573 604 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
Pfam:DUF4795 745 960 1.7e-46 PFAM
low complexity region 1095 1109 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171105
AA Change: F152S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127814
Gene: ENSMUSG00000022518
AA Change: F152S

DomainStartEndE-ValueType
Pfam:DUF4795 37 125 1.1e-20 PFAM
low complexity region 256 270 N/A INTRINSIC
low complexity region 272 286 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175762
AA Change: F55S
Predicted Effect probably benign
Transcript: ENSMUST00000176394
Predicted Effect probably benign
Transcript: ENSMUST00000176982
Predicted Effect probably benign
Transcript: ENSMUST00000180566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180939
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A G 7: 43,497,872 I218T possibly damaging Het
4931440F15Rik T C 11: 29,824,288 N390D probably benign Het
9930111J21Rik2 C T 11: 49,019,711 A632T possibly damaging Het
Akt1 A T 12: 112,658,616 L166Q probably null Het
Alpk2 A T 18: 65,266,248 D2086E probably damaging Het
Ankrd11 A T 8: 122,894,304 C915* probably null Het
Ankrd44 A T 1: 54,735,050 I398K probably damaging Het
Ankrd44 T C 1: 54,762,347 T274A probably damaging Het
Arhgef2 A G 3: 88,642,976 T663A probably benign Het
BC048403 T C 10: 121,740,147 probably benign Het
Btbd16 G A 7: 130,823,303 M471I possibly damaging Het
Btbd16 C A 7: 130,823,304 Q472K probably damaging Het
Cdc37 G A 9: 21,143,213 R39C probably damaging Het
Cnnm1 A G 19: 43,465,157 N537S possibly damaging Het
Cop1 T A 1: 159,250,073 D159E probably benign Het
Crtac1 C T 19: 42,413,951 V73I probably benign Het
Cryz T A 3: 154,606,518 V84E probably damaging Het
Ctnnd2 C T 15: 30,669,543 L433F probably benign Het
Ctsq C A 13: 61,037,060 D271Y probably benign Het
Cyp3a25 A C 5: 145,994,863 probably null Het
Dmbt1 G C 7: 131,054,067 W412C probably benign Het
Eif4e1b G A 13: 54,786,716 V131I possibly damaging Het
Epha1 A G 6: 42,364,634 V494A possibly damaging Het
Fbxl4 T C 4: 22,433,641 S593P probably damaging Het
Fbxo41 G A 6: 85,479,901 P429S probably benign Het
Fgfr3 G A 5: 33,730,003 C204Y probably damaging Het
Gbf1 T C 19: 46,284,422 V1665A possibly damaging Het
Htt T A 5: 34,905,397 V2825E probably damaging Het
Irs1 A T 1: 82,289,925 V190E probably damaging Het
Klk1 T C 7: 44,228,737 probably null Het
Kmt2d T C 15: 98,850,024 probably benign Het
Meox1 T C 11: 101,879,343 E186G probably damaging Het
Micu2 G A 14: 57,971,744 R86W probably damaging Het
Mrgprb1 A T 7: 48,447,684 I160K probably damaging Het
Nckap1l T A 15: 103,475,658 M561K possibly damaging Het
Olfr1199 A T 2: 88,756,405 I90N probably damaging Het
Olfr605 A T 7: 103,442,428 S232T probably damaging Het
Olfr689 A T 7: 105,314,006 M1L probably benign Het
Otoa T A 7: 121,121,977 L405H probably damaging Het
Phyhip A T 14: 70,466,874 M178L probably benign Het
Pkd1l3 A T 8: 109,655,520 N1630I probably damaging Het
Plek2 T A 12: 78,894,109 T247S probably benign Het
Rhbdl3 T C 11: 80,337,583 V293A probably damaging Het
Rock2 T A 12: 16,942,809 F193Y probably damaging Het
Scn3a C T 2: 65,460,713 M1896I probably benign Het
Snrnp200 T C 2: 127,226,013 V810A probably damaging Het
Taar4 G A 10: 23,960,741 S83N probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tec T A 5: 72,768,744 I322F possibly damaging Het
Teddm2 T C 1: 153,850,400 I190V probably benign Het
Tmem117 A G 15: 95,094,884 E475G probably damaging Het
Trip10 T A 17: 57,262,460 Y495N probably damaging Het
Ush2a T C 1: 188,906,498 V4035A possibly damaging Het
Utrn C T 10: 12,682,318 V1466M possibly damaging Het
Vasp A G 7: 19,257,891 probably benign Het
Vmn1r89 A T 7: 13,219,930 M130L possibly damaging Het
Vmn2r2 A T 3: 64,126,615 D495E possibly damaging Het
Zfp213 A G 17: 23,561,186 V120A possibly damaging Het
Other mutations in 4930562C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:4930562C15Rik APN 16 4864646 missense probably benign 0.31
IGL01610:4930562C15Rik APN 16 4851565 splice site probably benign
IGL02869:4930562C15Rik APN 16 4867459 missense possibly damaging 0.68
IGL03242:4930562C15Rik APN 16 4849325 missense unknown
R0063:4930562C15Rik UTSW 16 4861048 nonsense probably null
R0063:4930562C15Rik UTSW 16 4861048 nonsense probably null
R0083:4930562C15Rik UTSW 16 4849542 missense unknown
R0565:4930562C15Rik UTSW 16 4864336 missense probably benign 0.22
R0630:4930562C15Rik UTSW 16 4850939 missense possibly damaging 0.90
R0734:4930562C15Rik UTSW 16 4850334 missense probably benign 0.01
R1200:4930562C15Rik UTSW 16 4849672 missense unknown
R1738:4930562C15Rik UTSW 16 4864611 missense probably damaging 1.00
R1775:4930562C15Rik UTSW 16 4851558 splice site probably null
R1945:4930562C15Rik UTSW 16 4835685 missense unknown
R2132:4930562C15Rik UTSW 16 4835971 missense unknown
R2445:4930562C15Rik UTSW 16 4864397 splice site probably null
R2696:4930562C15Rik UTSW 16 4850364 missense probably benign 0.04
R4729:4930562C15Rik UTSW 16 4849323 missense unknown
R4779:4930562C15Rik UTSW 16 4849749 missense unknown
R4806:4930562C15Rik UTSW 16 4849672 missense unknown
R4808:4930562C15Rik UTSW 16 4849672 missense unknown
R4876:4930562C15Rik UTSW 16 4849672 missense unknown
R4931:4930562C15Rik UTSW 16 4861046 missense possibly damaging 0.47
R4956:4930562C15Rik UTSW 16 4854952 missense probably damaging 0.99
R5085:4930562C15Rik UTSW 16 4835973 nonsense probably null
R5203:4930562C15Rik UTSW 16 4835598 missense unknown
R5229:4930562C15Rik UTSW 16 4850051 missense possibly damaging 0.73
R5461:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5462:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5464:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R6054:4930562C15Rik UTSW 16 4835865 missense unknown
R6405:4930562C15Rik UTSW 16 4851878 missense probably damaging 0.97
R6859:4930562C15Rik UTSW 16 4851935 missense possibly damaging 0.86
R7124:4930562C15Rik UTSW 16 4864332 missense probably benign 0.02
R7139:4930562C15Rik UTSW 16 4850184 missense probably benign 0.00
R7182:4930562C15Rik UTSW 16 4849714 missense unknown
R7219:4930562C15Rik UTSW 16 4849644 missense unknown
R7366:4930562C15Rik UTSW 16 4835769 missense unknown
R7592:4930562C15Rik UTSW 16 4849274 missense unknown
R7759:4930562C15Rik UTSW 16 4864650 missense probably benign 0.01
R7789:4930562C15Rik UTSW 16 4864311 missense probably benign 0.01
R7873:4930562C15Rik UTSW 16 4866227 missense probably benign
R7916:4930562C15Rik UTSW 16 4864590 nonsense probably null
R8093:4930562C15Rik UTSW 16 4851504 missense possibly damaging 0.86
R8169:4930562C15Rik UTSW 16 4866218 missense probably benign 0.00
R8278:4930562C15Rik UTSW 16 4850176 missense probably benign 0.33
R8372:4930562C15Rik UTSW 16 4864288 missense probably damaging 0.99
R8493:4930562C15Rik UTSW 16 4835589 start codon destroyed unknown
R8549:4930562C15Rik UTSW 16 4863197 critical splice donor site probably null
X0028:4930562C15Rik UTSW 16 4867367 missense possibly damaging 0.83
Z1176:4930562C15Rik UTSW 16 4866248 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ATGTCTGTACTGGTTCACCAC -3'
(R):5'- AGCTTCCTCAAGGTACCCAAAG -3'

Sequencing Primer
(F):5'- TGATACTATCCAGAGCCCT -3'
(R):5'- GATCAGAGTTTCATCTCACATCTGGG -3'
Posted On2016-10-26