Incidental Mutation 'R5595:Crtac1'
ID437805
Institutional Source Beutler Lab
Gene Symbol Crtac1
Ensembl Gene ENSMUSG00000042401
Gene Namecartilage acidic protein 1
SynonymsLotus, Crtac1B, 2810454P21Rik
MMRRC Submission 043147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5595 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location42283037-42431783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42413951 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 73 (V73I)
Ref Sequence ENSEMBL: ENSMUSP00000044858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048630]
Predicted Effect probably benign
Transcript: ENSMUST00000048630
AA Change: V73I

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044858
Gene: ENSMUSG00000042401
AA Change: V73I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:VCBS 63 133 6.6e-12 PFAM
Pfam:VCBS 254 311 2e-12 PFAM
Pfam:VCBS 300 364 4.9e-13 PFAM
low complexity region 403 417 N/A INTRINSIC
Pfam:UnbV_ASPIC 459 528 8.9e-18 PFAM
Pfam:EGF_CA 560 606 2.1e-13 PFAM
low complexity region 630 646 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated extracellular matrix protein that is found in the interterritorial matrix of articular deep zone cartilage. This protein is used as a marker to distinguish chondrocytes from osteoblasts and mesenchymal stem cells in culture. The presence of FG-GAP motifs and an RGD integrin-binding motif suggests that this protein may be involved in cell-cell or cell-matrix interactions. Copy number alterations in this gene have been observed in neurofibromatosis type 1-associated glomus tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in lateral olfactory tract morphology and axon fasciculation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,864,279 F991S probably benign Het
4931406B18Rik A G 7: 43,497,872 I218T possibly damaging Het
4931440F15Rik T C 11: 29,824,288 N390D probably benign Het
9930111J21Rik2 C T 11: 49,019,711 A632T possibly damaging Het
Akt1 A T 12: 112,658,616 L166Q probably null Het
Alpk2 A T 18: 65,266,248 D2086E probably damaging Het
Ankrd11 A T 8: 122,894,304 C915* probably null Het
Ankrd44 A T 1: 54,735,050 I398K probably damaging Het
Ankrd44 T C 1: 54,762,347 T274A probably damaging Het
Arhgef2 A G 3: 88,642,976 T663A probably benign Het
BC048403 T C 10: 121,740,147 probably benign Het
Btbd16 G A 7: 130,823,303 M471I possibly damaging Het
Btbd16 C A 7: 130,823,304 Q472K probably damaging Het
Cdc37 G A 9: 21,143,213 R39C probably damaging Het
Cnnm1 A G 19: 43,465,157 N537S possibly damaging Het
Cop1 T A 1: 159,250,073 D159E probably benign Het
Cryz T A 3: 154,606,518 V84E probably damaging Het
Ctnnd2 C T 15: 30,669,543 L433F probably benign Het
Ctsq C A 13: 61,037,060 D271Y probably benign Het
Cyp3a25 A C 5: 145,994,863 probably null Het
Dmbt1 G C 7: 131,054,067 W412C probably benign Het
Eif4e1b G A 13: 54,786,716 V131I possibly damaging Het
Epha1 A G 6: 42,364,634 V494A possibly damaging Het
Fbxl4 T C 4: 22,433,641 S593P probably damaging Het
Fbxo41 G A 6: 85,479,901 P429S probably benign Het
Fgfr3 G A 5: 33,730,003 C204Y probably damaging Het
Gbf1 T C 19: 46,284,422 V1665A possibly damaging Het
Htt T A 5: 34,905,397 V2825E probably damaging Het
Irs1 A T 1: 82,289,925 V190E probably damaging Het
Klk1 T C 7: 44,228,737 probably null Het
Kmt2d T C 15: 98,850,024 probably benign Het
Meox1 T C 11: 101,879,343 E186G probably damaging Het
Micu2 G A 14: 57,971,744 R86W probably damaging Het
Mrgprb1 A T 7: 48,447,684 I160K probably damaging Het
Nckap1l T A 15: 103,475,658 M561K possibly damaging Het
Olfr1199 A T 2: 88,756,405 I90N probably damaging Het
Olfr605 A T 7: 103,442,428 S232T probably damaging Het
Olfr689 A T 7: 105,314,006 M1L probably benign Het
Otoa T A 7: 121,121,977 L405H probably damaging Het
Phyhip A T 14: 70,466,874 M178L probably benign Het
Pkd1l3 A T 8: 109,655,520 N1630I probably damaging Het
Plek2 T A 12: 78,894,109 T247S probably benign Het
Rhbdl3 T C 11: 80,337,583 V293A probably damaging Het
Rock2 T A 12: 16,942,809 F193Y probably damaging Het
Scn3a C T 2: 65,460,713 M1896I probably benign Het
Snrnp200 T C 2: 127,226,013 V810A probably damaging Het
Taar4 G A 10: 23,960,741 S83N probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tec T A 5: 72,768,744 I322F possibly damaging Het
Teddm2 T C 1: 153,850,400 I190V probably benign Het
Tmem117 A G 15: 95,094,884 E475G probably damaging Het
Trip10 T A 17: 57,262,460 Y495N probably damaging Het
Ush2a T C 1: 188,906,498 V4035A possibly damaging Het
Utrn C T 10: 12,682,318 V1466M possibly damaging Het
Vasp A G 7: 19,257,891 probably benign Het
Vmn1r89 A T 7: 13,219,930 M130L possibly damaging Het
Vmn2r2 A T 3: 64,126,615 D495E possibly damaging Het
Zfp213 A G 17: 23,561,186 V120A possibly damaging Het
Other mutations in Crtac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Crtac1 APN 19 42323794 missense probably damaging 1.00
IGL01296:Crtac1 APN 19 42284213 missense probably damaging 1.00
IGL01991:Crtac1 APN 19 42414121 missense possibly damaging 0.96
IGL02811:Crtac1 APN 19 42333911 missense probably damaging 1.00
R1957:Crtac1 UTSW 19 42287944 missense possibly damaging 0.79
R2046:Crtac1 UTSW 19 42334053 missense probably damaging 1.00
R2125:Crtac1 UTSW 19 42323732 missense probably damaging 1.00
R2280:Crtac1 UTSW 19 42283567 missense unknown
R2281:Crtac1 UTSW 19 42283567 missense unknown
R3508:Crtac1 UTSW 19 42304741 missense probably benign 0.09
R3923:Crtac1 UTSW 19 42333947 missense probably damaging 1.00
R4072:Crtac1 UTSW 19 42304707 missense probably damaging 1.00
R4798:Crtac1 UTSW 19 42323801 missense possibly damaging 0.93
R4951:Crtac1 UTSW 19 42414131 missense probably benign
R4965:Crtac1 UTSW 19 42318740 missense probably damaging 1.00
R5190:Crtac1 UTSW 19 42333908 missense possibly damaging 0.50
R5579:Crtac1 UTSW 19 42304806 missense probably damaging 1.00
R5739:Crtac1 UTSW 19 42302173 missense probably damaging 1.00
R5872:Crtac1 UTSW 19 42309190 splice site probably null
R5936:Crtac1 UTSW 19 42323837 missense probably damaging 1.00
R6149:Crtac1 UTSW 19 42283609 missense unknown
R6193:Crtac1 UTSW 19 42323797 missense possibly damaging 0.47
R6858:Crtac1 UTSW 19 42318735 missense possibly damaging 0.93
R7246:Crtac1 UTSW 19 42287926 missense probably benign
R7726:Crtac1 UTSW 19 42302251 nonsense probably null
X0018:Crtac1 UTSW 19 42309114 missense probably damaging 1.00
Z1176:Crtac1 UTSW 19 42287926 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGTGCCCCTACTTTGCAG -3'
(R):5'- TCAGGATGGCTTTGCTCCTG -3'

Sequencing Primer
(F):5'- CCCTACTTTGCAGAGGGC -3'
(R):5'- GGCTTTGCTCCTGCTGCC -3'
Posted On2016-10-26