Incidental Mutation 'R5596:Gjd2'
ID437809
Institutional Source Beutler Lab
Gene Symbol Gjd2
Ensembl Gene ENSMUSG00000068615
Gene Namegap junction protein, delta 2
Synonymsconnexin36, Cx36, Gja9
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location114009601-114013619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 114011484 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 171 (V171F)
Ref Sequence ENSEMBL: ENSMUSP00000087742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090275
AA Change: V171F

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087742
Gene: ENSMUSG00000068615
AA Change: V171F

DomainStartEndE-ValueType
CNX 44 77 1.01e-15 SMART
low complexity region 125 137 N/A INTRINSIC
Connexin_CCC 209 275 4.72e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152254
Meta Mutation Damage Score 0.0937 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the connexin protein family. Connexins are gap junction proteins which are arranged in groups of 6 around a central pore to form a connexon, a component of the gap junction intercellular channel. The channels formed by this protein allow cationic molecule exchange between human beta cells and may function in the regulation of insulin secretion. [provided by RefSeq, Oct 2012]
PHENOTYPE: Nullizygous mutations can cause loss of electrical synapses, impaired synchronous activity of inhibitory networks, altered spike synchrony in OB glomeruli, absent coupling of alpha-ganglion cells in retina, and abnormal cued conditioning, nerve fiber andsingle cell responses, and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Gjd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Gjd2 APN 2 114011777 missense probably damaging 1.00
IGL01759:Gjd2 APN 2 114011106 missense probably benign 0.00
IGL02307:Gjd2 APN 2 114011913 missense possibly damaging 0.95
IGL02862:Gjd2 APN 2 114013143 utr 5 prime probably benign
IGL03206:Gjd2 APN 2 114011723 missense probably damaging 1.00
R0212:Gjd2 UTSW 2 114011472 missense probably benign 0.00
R1306:Gjd2 UTSW 2 114011865 missense probably damaging 0.97
R1637:Gjd2 UTSW 2 114011308 nonsense probably null
R1719:Gjd2 UTSW 2 114013133 start codon destroyed probably null 1.00
R2051:Gjd2 UTSW 2 114011058 missense probably damaging 1.00
R4809:Gjd2 UTSW 2 114011541 missense probably damaging 1.00
R6891:Gjd2 UTSW 2 114013094 missense possibly damaging 0.85
R7338:Gjd2 UTSW 2 114011102 missense probably damaging 1.00
R7461:Gjd2 UTSW 2 114011118 missense possibly damaging 0.94
R7693:Gjd2 UTSW 2 114011828 missense probably damaging 1.00
X0065:Gjd2 UTSW 2 114011637 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCTTGATGCAGGGGTAACG -3'
(R):5'- AGAACGCCGGTACTCTACTGTC -3'

Sequencing Primer
(F):5'- GGGTAACGGTTGCACTCATAC -3'
(R):5'- TCTTCCTAGCCCTGGACAGAGAC -3'
Posted On2016-10-26