Incidental Mutation 'R5596:Tdpoz4'
ID437817
Institutional Source Beutler Lab
Gene Symbol Tdpoz4
Ensembl Gene ENSMUSG00000060256
Gene NameTD and POZ domain containing 4
Synonyms
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.781) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location93796398-93797510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93797499 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 368 (T368S)
Ref Sequence ENSEMBL: ENSMUSP00000075338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075953]
Predicted Effect probably benign
Transcript: ENSMUST00000075953
AA Change: T368S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075338
Gene: ENSMUSG00000060256
AA Change: T368S

DomainStartEndE-ValueType
MATH 24 130 4.81e-2 SMART
BTB 188 287 2.9e-26 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Tdpoz4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Tdpoz4 APN 3 93797073 missense probably benign 0.22
IGL01731:Tdpoz4 APN 3 93796882 missense possibly damaging 0.62
IGL01934:Tdpoz4 APN 3 93797472 missense probably damaging 1.00
IGL03269:Tdpoz4 APN 3 93796837 missense probably damaging 1.00
FR4340:Tdpoz4 UTSW 3 93796880 frame shift probably null
FR4342:Tdpoz4 UTSW 3 93796880 frame shift probably null
R0387:Tdpoz4 UTSW 3 93796700 missense probably benign 0.26
R1134:Tdpoz4 UTSW 3 93797218 missense probably benign 0.42
R1299:Tdpoz4 UTSW 3 93796462 missense probably benign 0.26
R1574:Tdpoz4 UTSW 3 93796528 missense probably benign 0.16
R1574:Tdpoz4 UTSW 3 93796528 missense probably benign 0.16
R2113:Tdpoz4 UTSW 3 93797044 missense probably damaging 1.00
R4601:Tdpoz4 UTSW 3 93797032 missense probably damaging 1.00
R4738:Tdpoz4 UTSW 3 93797089 missense probably damaging 1.00
R4948:Tdpoz4 UTSW 3 93797011 missense probably damaging 1.00
R5495:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5519:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5550:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5595:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5615:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R7198:Tdpoz4 UTSW 3 93797355 missense probably benign 0.16
R7290:Tdpoz4 UTSW 3 93796848 missense not run
R7677:Tdpoz4 UTSW 3 93797508 makesense probably null
X0066:Tdpoz4 UTSW 3 93796968 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCCTCTCTGTGGAGAATGC -3'
(R):5'- TCCAGATTCCAATGCTGTCC -3'

Sequencing Primer
(F):5'- TGAAGACTCAGGCCCTGGATTTC -3'
(R):5'- AGATTCCAATGCTGTCCATTTTC -3'
Posted On2016-10-26