Incidental Mutation 'R5596:Musk'
ID437819
Institutional Source Beutler Lab
Gene Symbol Musk
Ensembl Gene ENSMUSG00000057280
Gene Namemuscle, skeletal, receptor tyrosine kinase
SynonymsMDK4, Nsk1, Nsk2, Nsk3
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58285960-58374303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58373036 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 654 (C654R)
Ref Sequence ENSEMBL: ENSMUSP00000137453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081919] [ENSMUST00000084578] [ENSMUST00000098057] [ENSMUST00000098059] [ENSMUST00000102893] [ENSMUST00000177951] [ENSMUST00000179951]
Predicted Effect probably damaging
Transcript: ENSMUST00000081919
AA Change: C644R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080590
Gene: ENSMUSG00000057280
AA Change: C644R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084578
AA Change: C644R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081625
Gene: ENSMUSG00000057280
AA Change: C644R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.2e-28 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098057
AA Change: C669R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095665
Gene: ENSMUSG00000057280
AA Change: C669R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 342 467 1.4e-15 PFAM
transmembrane domain 520 542 N/A INTRINSIC
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 592 N/A INTRINSIC
TyrKc 599 880 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098059
AA Change: C646R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095667
Gene: ENSMUSG00000057280
AA Change: C646R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 2.1e-28 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102893
AA Change: C636R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099957
Gene: ENSMUSG00000057280
AA Change: C636R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 487 509 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
TyrKc 566 847 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177951
AA Change: C646R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136696
Gene: ENSMUSG00000057280
AA Change: C646R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 327 458 1.1e-27 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179951
AA Change: C654R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137453
Gene: ENSMUSG00000057280
AA Change: C654R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 1.2e-27 PFAM
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
TyrKc 584 865 2.96e-140 SMART
Meta Mutation Damage Score 0.8960 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is a type 1 receptor-like protein located in muscle membrane that is activated by the heparan sulfate proteoglycan agrin released by nerve cells. The encoded protein activates signaling cascades responsible for multiple aspects of motor neuron and muscle development, including organization of the postsynaptic membrane, synaptic gene transcription, patterning of skeletal muscle, anchoring of acetylcholinesterase, and guidance of motor axons. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack neuromuscular synapses and spontaneous movement, and die at birth of respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Musk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Musk APN 4 58367539 missense probably damaging 1.00
IGL01727:Musk APN 4 58303887 missense probably benign 0.37
IGL01981:Musk APN 4 58296629 missense probably damaging 1.00
IGL02064:Musk APN 4 58286128 missense possibly damaging 0.89
IGL02326:Musk APN 4 58354113 missense probably benign 0.02
IGL02475:Musk APN 4 58353936 critical splice acceptor site probably benign
IGL02585:Musk APN 4 58347849 missense probably benign
IGL02719:Musk APN 4 58356496 missense probably benign
IGL02797:Musk APN 4 58366921 missense probably benign 0.00
IGL02869:Musk APN 4 58354078 missense probably benign 0.05
IGL02940:Musk APN 4 58373364 missense probably damaging 1.00
IGL03167:Musk APN 4 58366821 missense possibly damaging 0.81
IGL03230:Musk APN 4 58296710 missense probably damaging 1.00
R0384:Musk UTSW 4 58373711 makesense probably null
R1014:Musk UTSW 4 58354156 missense possibly damaging 0.88
R1462:Musk UTSW 4 58286204 splice site probably benign
R1493:Musk UTSW 4 58354003 missense probably benign 0.19
R1739:Musk UTSW 4 58293563 missense probably damaging 1.00
R1883:Musk UTSW 4 58373189 missense probably benign 0.18
R2230:Musk UTSW 4 58333672 missense possibly damaging 0.79
R2914:Musk UTSW 4 58366938 missense probably damaging 0.99
R3508:Musk UTSW 4 58327347 missense probably damaging 0.98
R4225:Musk UTSW 4 58373240 missense probably damaging 0.99
R4601:Musk UTSW 4 58301625 missense probably damaging 0.99
R4771:Musk UTSW 4 58301706 missense probably benign 0.16
R4793:Musk UTSW 4 58373400 missense probably damaging 1.00
R4845:Musk UTSW 4 58296679 missense probably damaging 1.00
R4919:Musk UTSW 4 58366899 missense probably damaging 1.00
R4954:Musk UTSW 4 58344222 missense probably damaging 0.96
R5715:Musk UTSW 4 58333663 missense probably damaging 1.00
R5894:Musk UTSW 4 58373583 missense probably damaging 1.00
R5934:Musk UTSW 4 58373613 missense probably damaging 1.00
R6230:Musk UTSW 4 58367576 missense probably damaging 1.00
R6335:Musk UTSW 4 58366811 missense probably benign
R6358:Musk UTSW 4 58373171 missense possibly damaging 0.72
R6395:Musk UTSW 4 58286169 missense probably benign
R6652:Musk UTSW 4 58368977 missense probably damaging 1.00
R6764:Musk UTSW 4 58354027 missense probably damaging 1.00
R7233:Musk UTSW 4 58373307 missense possibly damaging 0.83
R7238:Musk UTSW 4 58344312 missense probably benign 0.01
R7271:Musk UTSW 4 58373409 missense probably damaging 1.00
R7511:Musk UTSW 4 58333672 missense probably benign 0.10
X0020:Musk UTSW 4 58368996 missense probably damaging 1.00
X0066:Musk UTSW 4 58327356 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGACTCTTACTAGATAACGGGATG -3'
(R):5'- ACTTGCGCTCTGAAAGGTAGG -3'

Sequencing Primer
(F):5'- TGTTTAAGTAAAGACGTGGGAGTC -3'
(R):5'- CTGGCAATGCAGAGCTGTTC -3'
Posted On2016-10-26