Incidental Mutation 'R0063:Tulp2'
ID 43782
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Name tubby-like protein 2
Synonyms
MMRRC Submission 038355-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R0063 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45131450-45173070 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 45170284 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000167273] [ENSMUST00000209763] [ENSMUST00000210299] [ENSMUST00000210813] [ENSMUST00000210868] [ENSMUST00000211212] [ENSMUST00000210532]
AlphaFold P46686
Predicted Effect probably benign
Transcript: ENSMUST00000024233
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042105
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085331
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107758
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107762
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167273
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209763
Predicted Effect probably benign
Transcript: ENSMUST00000210299
Predicted Effect probably benign
Transcript: ENSMUST00000210813
Predicted Effect probably benign
Transcript: ENSMUST00000210868
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211413
Predicted Effect probably benign
Transcript: ENSMUST00000210532
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik C T 16: 4,678,912 (GRCm39) R245* probably null Het
4930563I02Rik T A 14: 60,333,477 (GRCm39) probably benign Het
Acss1 T C 2: 150,469,212 (GRCm39) T435A probably damaging Het
Aoc2 T A 11: 101,216,897 (GRCm39) S327T probably damaging Het
Arid5a T A 1: 36,357,645 (GRCm39) Y252N probably damaging Het
AU040320 T C 4: 126,733,465 (GRCm39) Y662H probably damaging Het
B4gat1 T A 19: 5,089,735 (GRCm39) L244* probably null Het
Bcam C T 7: 19,500,773 (GRCm39) V134I probably benign Het
Btbd16 A T 7: 130,424,896 (GRCm39) T426S probably benign Het
Btn1a1 C T 13: 23,649,267 (GRCm39) probably null Het
Cap2 T C 13: 46,791,508 (GRCm39) probably benign Het
Capn8 T A 1: 182,429,677 (GRCm39) D299E probably damaging Het
Cdipt G A 7: 126,578,772 (GRCm39) V160I probably benign Het
Cep164 A G 9: 45,679,916 (GRCm39) S1267P possibly damaging Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Col3a1 T C 1: 45,369,701 (GRCm39) probably benign Het
Cyb5r3 T C 15: 83,046,137 (GRCm39) T60A probably benign Het
Dgkb T G 12: 38,654,112 (GRCm39) S744A probably benign Het
Dock2 T A 11: 34,647,111 (GRCm39) probably null Het
Ece1 C T 4: 137,675,892 (GRCm39) T422M probably benign Het
Ece2 A G 16: 20,461,067 (GRCm39) T442A probably benign Het
Elapor2 T C 5: 9,490,709 (GRCm39) probably benign Het
Eml3 C A 19: 8,915,842 (GRCm39) A644D probably damaging Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Foxp1 A G 6: 98,921,684 (GRCm39) probably benign Het
Gm10801 G T 2: 98,494,185 (GRCm39) S109I probably benign Het
Il17rd G A 14: 26,804,690 (GRCm39) C88Y probably damaging Het
Il17rd C A 14: 26,804,691 (GRCm39) C88* probably null Het
Ino80c A G 18: 24,239,681 (GRCm39) F160S probably damaging Het
Ints8 T C 4: 11,252,857 (GRCm39) N75S probably damaging Het
Irf2bp1 C T 7: 18,739,772 (GRCm39) R471C possibly damaging Het
Irs1 T A 1: 82,266,580 (GRCm39) E545D probably damaging Het
Lama3 T C 18: 12,661,762 (GRCm39) probably benign Het
Mast4 C A 13: 103,470,723 (GRCm39) probably benign Het
Mcc C G 18: 44,652,583 (GRCm39) probably benign Het
Nat8f2 A T 6: 85,844,815 (GRCm39) S182R possibly damaging Het
Nrcam G T 12: 44,596,811 (GRCm39) V343F possibly damaging Het
Opn5 T C 17: 42,907,517 (GRCm39) S120G probably damaging Het
Pdk2 T C 11: 94,923,306 (GRCm39) H106R probably benign Het
Pkhd1 G A 1: 20,282,174 (GRCm39) T2889I probably benign Het
Pkhd1l1 T A 15: 44,392,633 (GRCm39) L1656H probably damaging Het
Plxna2 A T 1: 194,327,247 (GRCm39) T394S probably benign Het
Pnpla8 T A 12: 44,329,615 (GRCm39) C56S probably damaging Het
Prdm8 G T 5: 98,332,453 (GRCm39) R118L probably damaging Het
Prkce T C 17: 86,789,539 (GRCm39) probably benign Het
Ptprk T A 10: 28,139,763 (GRCm39) Y163N probably damaging Het
Rbbp8 T A 18: 11,867,614 (GRCm39) probably benign Het
Rnh1 A T 7: 140,744,109 (GRCm39) probably null Het
Rtn4 T A 11: 29,655,527 (GRCm39) probably benign Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Slc2a2 T C 3: 28,771,589 (GRCm39) M173T probably damaging Het
Slc2a8 T A 2: 32,870,011 (GRCm39) probably null Het
Tdpoz1 A T 3: 93,578,121 (GRCm39) M221K probably benign Het
Tgm7 G T 2: 120,924,577 (GRCm39) H533Q probably benign Het
Timm29 C A 9: 21,504,304 (GRCm39) A17E probably benign Het
Tmem131 C T 1: 36,858,209 (GRCm39) V713I probably benign Het
Tmem89 A G 9: 108,743,880 (GRCm39) N60S probably benign Het
Tpx2 A G 2: 152,722,043 (GRCm39) T212A probably damaging Het
Trio G T 15: 27,881,523 (GRCm39) probably benign Het
Uggt2 A G 14: 119,244,542 (GRCm39) probably benign Het
Vmn2r5 T A 3: 64,411,221 (GRCm39) E449V probably benign Het
Vwa8 A G 14: 79,401,656 (GRCm39) probably benign Het
Xirp2 A G 2: 67,339,427 (GRCm39) D556G probably damaging Het
Xrn1 T C 9: 95,851,588 (GRCm39) L202P probably damaging Het
Zfp354a A T 11: 50,960,398 (GRCm39) H203L probably damaging Het
Zfp53 A C 17: 21,728,367 (GRCm39) R133S probably benign Het
Zfp787 C T 7: 6,135,322 (GRCm39) probably null Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45,171,332 (GRCm39) missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45,165,692 (GRCm39) missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45,170,219 (GRCm39) missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45,171,734 (GRCm39) missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45,171,282 (GRCm39) missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45,165,696 (GRCm39) missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0306:Tulp2 UTSW 7 45,168,000 (GRCm39) unclassified probably benign
R0648:Tulp2 UTSW 7 45,169,210 (GRCm39) missense probably damaging 1.00
R0710:Tulp2 UTSW 7 45,170,232 (GRCm39) missense possibly damaging 0.92
R1168:Tulp2 UTSW 7 45,167,266 (GRCm39) missense probably benign
R1345:Tulp2 UTSW 7 45,168,145 (GRCm39) missense probably benign 0.13
R1737:Tulp2 UTSW 7 45,169,201 (GRCm39) missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45,167,367 (GRCm39) missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45,167,365 (GRCm39) missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45,168,052 (GRCm39) missense possibly damaging 0.85
R3012:Tulp2 UTSW 7 45,168,187 (GRCm39) missense probably damaging 1.00
R3419:Tulp2 UTSW 7 45,168,176 (GRCm39) missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45,171,298 (GRCm39) missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45,167,348 (GRCm39) missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45,166,075 (GRCm39) missense possibly damaging 0.95
R6056:Tulp2 UTSW 7 45,139,797 (GRCm39) splice site probably null
R6294:Tulp2 UTSW 7 45,164,116 (GRCm39) missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45,168,012 (GRCm39) missense probably benign 0.01
R6875:Tulp2 UTSW 7 45,168,038 (GRCm39) missense probably benign 0.05
R7459:Tulp2 UTSW 7 45,169,227 (GRCm39) missense probably damaging 1.00
R7556:Tulp2 UTSW 7 45,168,005 (GRCm39) splice site probably null
R7676:Tulp2 UTSW 7 45,170,451 (GRCm39) missense possibly damaging 0.86
R7883:Tulp2 UTSW 7 45,166,188 (GRCm39) splice site probably null
R8775:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8775-TAIL:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8804:Tulp2 UTSW 7 45,170,398 (GRCm39) missense probably damaging 1.00
Z1088:Tulp2 UTSW 7 45,171,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGATTGTCACTCTGTCCACCAC -3'
(R):5'- ACATGACCTGATAGCCGTTGTCCC -3'

Sequencing Primer
(F):5'- ACCCTCCTGGAGCAGATCC -3'
(R):5'- TCCCACCTGAGATCTATGATGGAG -3'
Posted On 2013-05-29