Incidental Mutation 'R5596:Cyp2j8'
ID437821
Institutional Source Beutler Lab
Gene Symbol Cyp2j8
Ensembl Gene ENSMUSG00000082932
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 8
SynonymsCyp2j8-ps, OTTMUSG00000007938
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location96444596-96507386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96507341 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 16 (I16F)
Ref Sequence ENSEMBL: ENSMUSP00000134591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124729]
Predicted Effect probably benign
Transcript: ENSMUST00000124729
AA Change: I16F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134591
Gene: ENSMUSG00000082932
AA Change: I16F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 500 1.2e-134 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Cyp2j8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2j8 APN 4 96503842 missense probably benign 0.06
IGL00418:Cyp2j8 APN 4 96444616 missense possibly damaging 0.85
IGL01577:Cyp2j8 APN 4 96479071 missense probably damaging 0.96
IGL01629:Cyp2j8 APN 4 96499603 missense probably damaging 1.00
IGL01928:Cyp2j8 APN 4 96470476 splice site probably benign
IGL01978:Cyp2j8 APN 4 96504009 splice site probably null
IGL02053:Cyp2j8 APN 4 96470654 missense probably damaging 1.00
IGL02500:Cyp2j8 APN 4 96470650 missense probably damaging 1.00
IGL02947:Cyp2j8 APN 4 96470578 missense probably damaging 1.00
R0558:Cyp2j8 UTSW 4 96444634 missense probably benign 0.01
R0718:Cyp2j8 UTSW 4 96501196 missense probably benign
R1553:Cyp2j8 UTSW 4 96475557 missense probably benign
R1557:Cyp2j8 UTSW 4 96470476 splice site probably benign
R1632:Cyp2j8 UTSW 4 96447324 missense probably benign 0.02
R1708:Cyp2j8 UTSW 4 96499595 missense probably damaging 1.00
R2119:Cyp2j8 UTSW 4 96507201 missense probably benign
R2220:Cyp2j8 UTSW 4 96444625 missense probably benign 0.03
R3123:Cyp2j8 UTSW 4 96501213 splice site probably benign
R3735:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R3736:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R4326:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4327:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4762:Cyp2j8 UTSW 4 96470649 missense probably damaging 1.00
R4901:Cyp2j8 UTSW 4 96479086 missense probably benign 0.16
R4960:Cyp2j8 UTSW 4 96507377 missense probably benign
R5260:Cyp2j8 UTSW 4 96501064 missense possibly damaging 0.65
R5562:Cyp2j8 UTSW 4 96470653 missense probably damaging 1.00
R5741:Cyp2j8 UTSW 4 96444643 missense probably benign 0.00
R5825:Cyp2j8 UTSW 4 96507214 missense probably benign 0.01
R5903:Cyp2j8 UTSW 4 96507277 missense possibly damaging 0.46
R6122:Cyp2j8 UTSW 4 96444640 missense probably benign
R6232:Cyp2j8 UTSW 4 96507190 missense possibly damaging 0.94
R6748:Cyp2j8 UTSW 4 96475545 missense probably benign 0.01
R6931:Cyp2j8 UTSW 4 96444781 splice site probably null
R7000:Cyp2j8 UTSW 4 96447351 missense probably benign 0.06
R7183:Cyp2j8 UTSW 4 96479181 missense probably damaging 0.97
R7186:Cyp2j8 UTSW 4 96475550 missense probably benign 0.00
R7348:Cyp2j8 UTSW 4 96444640 missense probably benign 0.00
R7575:Cyp2j8 UTSW 4 96470548 missense possibly damaging 0.63
R7648:Cyp2j8 UTSW 4 96499603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCTTACCGGCTGGATCC -3'
(R):5'- TTCGTTGCAGAAGACTGGCAG -3'

Sequencing Primer
(F):5'- CTGGATCCCCAAATGCAGATGTG -3'
(R):5'- CTAATAGGGATAGGGTGAATGTACC -3'
Posted On2016-10-26