Incidental Mutation 'R5596:Capzb'
ID437822
Institutional Source Beutler Lab
Gene Symbol Capzb
Ensembl Gene ENSMUSG00000028745
Gene Namecapping protein (actin filament) muscle Z-line, beta
Synonyms1700120C01Rik, CPB2, Cappb1, CPbeta1, CPbeta2, CPB1
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location139192899-139291818 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 139279427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030518] [ENSMUST00000042675] [ENSMUST00000102507] [ENSMUST00000102508] [ENSMUST00000131912] [ENSMUST00000138045]
Predicted Effect probably benign
Transcript: ENSMUST00000030518
SMART Domains Protein: ENSMUSP00000030518
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 35 269 6.2e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042675
SMART Domains Protein: ENSMUSP00000038011
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 1 228 4.7e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102507
SMART Domains Protein: ENSMUSP00000099565
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 6 240 4.6e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102508
SMART Domains Protein: ENSMUSP00000099566
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 5 240 6.8e-115 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000131912
AA Change: L151W
SMART Domains Protein: ENSMUSP00000114973
Gene: ENSMUSG00000028745
AA Change: L151W

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 5 113 1.5e-53 PFAM
low complexity region 115 126 N/A INTRINSIC
Pfam:F_actin_cap_B 143 188 4.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138045
SMART Domains Protein: ENSMUSP00000122077
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 1 204 9.8e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150077
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of a highly conserved filamentous actin capping protein that binds the barbed end of filamentous actin to stabilize it and terminate elongation. Interaction of this protein with the barbed end of the actin filament occurs through binding of the amphipathic helix at the C-terminus to the hydrophobic cleft on the actin molecule. This gene is required for a variety of dynamic actin-mediated processes including organization of lamellipodia and filopodia, growth cone morphology and neurite outgrowth in hippocampal neurons, and asymmetric spindle migration and polar body extrusion during oocyte maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in the ear exhibit increased ABR threshold, absent DPOE, reduced vestibular function, head shaking and abnormal stereocilia length and width in the cochlea and utricle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Capzb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Capzb APN 4 139288947 missense probably benign 0.00
IGL00885:Capzb APN 4 139287050 missense probably benign 0.00
R0612:Capzb UTSW 4 139291029 missense probably benign
R0729:Capzb UTSW 4 139288977 unclassified probably benign
R1547:Capzb UTSW 4 139262098 unclassified probably null
R1731:Capzb UTSW 4 139280030 missense probably damaging 1.00
R1748:Capzb UTSW 4 139257368 missense probably damaging 1.00
R2234:Capzb UTSW 4 139262023 missense possibly damaging 0.80
R2424:Capzb UTSW 4 139194130 start codon destroyed probably null 0.01
R4799:Capzb UTSW 4 139192999 utr 5 prime probably benign
R5076:Capzb UTSW 4 139287814 missense possibly damaging 0.85
R6200:Capzb UTSW 4 139280013 missense probably benign 0.33
R7587:Capzb UTSW 4 139262023 missense possibly damaging 0.80
R7763:Capzb UTSW 4 139280553 missense probably benign
X0012:Capzb UTSW 4 139257291 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTTGGGACCCTAGCTGCATG -3'
(R):5'- GCTGGCCATCACCTCATTTAAC -3'

Sequencing Primer
(F):5'- GACCCTAGCTGCATGGCTTC -3'
(R):5'- TGAAGGTCCTGAGTTCAATCCCAG -3'
Posted On2016-10-26