Incidental Mutation 'R5596:Ccdc149'
ID437826
Institutional Source Beutler Lab
Gene Symbol Ccdc149
Ensembl Gene ENSMUSG00000045790
Gene Namecoiled-coil domain containing 149
SynonymsGm447, LOC242997
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location52374651-52471521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52404151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 229 (V229A)
Ref Sequence ENSEMBL: ENSMUSP00000062411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059428] [ENSMUST00000198008]
Predicted Effect probably damaging
Transcript: ENSMUST00000059428
AA Change: V229A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062411
Gene: ENSMUSG00000045790
AA Change: V229A

DomainStartEndE-ValueType
Pfam:DUF2353 21 333 3.5e-117 PFAM
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198008
SMART Domains Protein: ENSMUSP00000143041
Gene: ENSMUSG00000045790

DomainStartEndE-ValueType
Pfam:DUF2353 21 138 1.5e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000213027
AA Change: V42A
Meta Mutation Damage Score 0.0966 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Ccdc149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Ccdc149 APN 5 52376322 missense probably benign 0.15
IGL02002:Ccdc149 APN 5 52406079 missense probably damaging 1.00
pequeno UTSW 5 52405133 nonsense probably null
R0226:Ccdc149 UTSW 5 52400217 missense probably damaging 1.00
R0420:Ccdc149 UTSW 5 52400239 splice site probably benign
R0959:Ccdc149 UTSW 5 52385155 missense probably damaging 1.00
R2075:Ccdc149 UTSW 5 52439168 missense probably damaging 1.00
R2355:Ccdc149 UTSW 5 52420772 missense probably damaging 0.99
R4755:Ccdc149 UTSW 5 52404151 missense probably damaging 0.96
R5955:Ccdc149 UTSW 5 52376535 missense probably benign 0.00
R5993:Ccdc149 UTSW 5 52402775 missense probably damaging 1.00
R6351:Ccdc149 UTSW 5 52385135 missense probably benign
R6742:Ccdc149 UTSW 5 52405133 nonsense probably null
R6939:Ccdc149 UTSW 5 52376265 missense probably benign 0.00
R6963:Ccdc149 UTSW 5 52439097 missense probably damaging 1.00
R7379:Ccdc149 UTSW 5 52405066 missense probably damaging 0.99
R7715:Ccdc149 UTSW 5 52404191 critical splice acceptor site probably null
R8154:Ccdc149 UTSW 5 52385104 critical splice donor site probably null
Z1176:Ccdc149 UTSW 5 52420813 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCTGGCTACTCCAATTAGGG -3'
(R):5'- GCATGTCTGACCTTGATCACATC -3'

Sequencing Primer
(F):5'- CTCCAATTAGGGGTCCTATTGG -3'
(R):5'- AAAAGGTCACATTTTCCTGCC -3'
Posted On2016-10-26