Incidental Mutation 'R5596:Abraxas1'
ID437827
Institutional Source Beutler Lab
Gene Symbol Abraxas1
Ensembl Gene ENSMUSG00000035234
Gene NameBRCA1 A complex subunit
Synonyms3830405G04Rik, Fam175a, Ccdc98, 5630400M01Rik
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location100805192-100820965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100818537 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 53 (V53D)
Ref Sequence ENSEMBL: ENSMUSP00000143465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044535] [ENSMUST00000055245] [ENSMUST00000117364] [ENSMUST00000129358] [ENSMUST00000153302] [ENSMUST00000200657]
Predicted Effect probably damaging
Transcript: ENSMUST00000044535
AA Change: V53D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000055245
AA Change: V53D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055895
Gene: ENSMUSG00000035234
AA Change: V53D

DomainStartEndE-ValueType
coiled coil region 210 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117364
AA Change: V53D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114050
Gene: ENSMUSG00000035234
AA Change: V53D

DomainStartEndE-ValueType
coiled coil region 210 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129358
AA Change: V53D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145707
Predicted Effect probably benign
Transcript: ENSMUST00000153302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199779
Predicted Effect probably damaging
Transcript: ENSMUST00000200657
AA Change: V53D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143465
Gene: ENSMUSG00000035234
AA Change: V53D

DomainStartEndE-ValueType
coiled coil region 210 261 N/A INTRINSIC
Meta Mutation Damage Score 0.2510 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the C-terminal repeats of breast cancer 1 (BRCA1) through a phospho-SXXF motif. The encoded protein recruits ubiquitin interaction motif containing 1 protein to BRCA1 protein and is required for DNA damage resistance, DNA repair, and cell cycle checkpoint control. Pseudogenes of this gene are found on chromosomes 3 and 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Abraxas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0658:Abraxas1 UTSW 5 100817961 critical splice donor site probably null
R1591:Abraxas1 UTSW 5 100809639 missense probably benign 0.00
R1779:Abraxas1 UTSW 5 100817956 splice site probably benign
R2421:Abraxas1 UTSW 5 100812174 missense possibly damaging 0.82
R2904:Abraxas1 UTSW 5 100809807 missense probably benign 0.13
R4739:Abraxas1 UTSW 5 100812020 missense probably damaging 1.00
R5563:Abraxas1 UTSW 5 100812174 missense possibly damaging 0.82
R5631:Abraxas1 UTSW 5 100817974 missense probably damaging 1.00
R5903:Abraxas1 UTSW 5 100817958 splice site probably null
R5983:Abraxas1 UTSW 5 100807911 missense probably benign
R7059:Abraxas1 UTSW 5 100806237 missense probably benign 0.06
R7818:Abraxas1 UTSW 5 100806310 missense probably benign 0.04
R7846:Abraxas1 UTSW 5 100806832 missense probably damaging 0.99
R7929:Abraxas1 UTSW 5 100806832 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGTGCTTTTCAAAACATTACCG -3'
(R):5'- AACAAATCAGTTCCACTCTGTCTC -3'

Sequencing Primer
(F):5'- CACACATGTGTATATTCCCCA -3'
(R):5'- GTGCCCACTACCTATAACACATTTG -3'
Posted On2016-10-26