Incidental Mutation 'R5596:Cftr'
ID437829
Institutional Source Beutler Lab
Gene Symbol Cftr
Ensembl Gene ENSMUSG00000041301
Gene Namecystic fibrosis transmembrane conductance regulator
SynonymsAbcc7
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location18170687-18322768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18268096 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 685 (T685A)
Ref Sequence ENSEMBL: ENSMUSP00000111065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000140407]
Predicted Effect probably benign
Transcript: ENSMUST00000045706
AA Change: T715A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: T715A

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.7e-40 PFAM
AAA 450 623 2.16e-12 SMART
Pfam:CFTR_R 639 844 2e-93 PFAM
Pfam:ABC_membrane 857 1142 2.7e-53 PFAM
AAA 1232 1414 9.94e-12 SMART
low complexity region 1465 1474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115405
SMART Domains Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.4e-48 PFAM
Pfam:ABC_tran 441 570 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115406
AA Change: T685A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: T685A

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 167 4e-14 PFAM
Pfam:ABC_membrane 162 320 2.5e-20 PFAM
AAA 420 593 2.16e-12 SMART
Pfam:CFTR_R 609 815 1.3e-97 PFAM
Pfam:ABC_membrane 827 1112 1e-50 PFAM
AAA 1202 1384 9.94e-12 SMART
low complexity region 1435 1444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140407
SMART Domains Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.2e-48 PFAM
Pfam:ABC_tran 441 568 6.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143135
Meta Mutation Damage Score 0.1411 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Cftr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cftr APN 6 18268430 critical splice donor site probably null
IGL01082:Cftr APN 6 18226103 missense probably damaging 0.97
IGL01113:Cftr APN 6 18270253 missense probably damaging 1.00
IGL01383:Cftr APN 6 18226041 missense probably benign 0.00
IGL01595:Cftr APN 6 18198239 splice site probably benign
IGL01820:Cftr APN 6 18226139 missense probably damaging 1.00
IGL02223:Cftr APN 6 18221482 missense probably damaging 1.00
IGL02249:Cftr APN 6 18277871 missense possibly damaging 0.58
IGL02439:Cftr APN 6 18258238 nonsense probably null
IGL02537:Cftr APN 6 18274597 missense probably benign 0.31
IGL03234:Cftr APN 6 18225988 missense probably damaging 0.96
PIT4453001:Cftr UTSW 6 18214106 missense probably damaging 0.99
PIT4520001:Cftr UTSW 6 18277843 missense probably benign 0.01
R0114:Cftr UTSW 6 18282448 missense probably damaging 1.00
R0329:Cftr UTSW 6 18226097 missense probably null 1.00
R0330:Cftr UTSW 6 18226097 missense probably null 1.00
R0331:Cftr UTSW 6 18235226 missense possibly damaging 0.72
R0480:Cftr UTSW 6 18274518 splice site probably benign
R0612:Cftr UTSW 6 18198126 missense probably benign 0.01
R0633:Cftr UTSW 6 18305980 missense probably damaging 0.99
R0830:Cftr UTSW 6 18270225 missense probably benign 0.02
R1559:Cftr UTSW 6 18225937 missense probably benign 0.01
R1629:Cftr UTSW 6 18226106 missense probably damaging 1.00
R1636:Cftr UTSW 6 18226157 missense probably damaging 0.99
R1860:Cftr UTSW 6 18268289 missense probably benign 0.00
R2043:Cftr UTSW 6 18320935 missense probably benign
R2211:Cftr UTSW 6 18214280 missense probably null 0.13
R4737:Cftr UTSW 6 18299883 missense probably benign 0.19
R4793:Cftr UTSW 6 18226088 missense probably damaging 1.00
R4857:Cftr UTSW 6 18320975 missense possibly damaging 0.92
R4984:Cftr UTSW 6 18235199 missense possibly damaging 0.89
R4999:Cftr UTSW 6 18221614 missense probably benign 0.17
R5045:Cftr UTSW 6 18230081 missense probably benign 0.20
R5183:Cftr UTSW 6 18299833 missense probably damaging 0.99
R5197:Cftr UTSW 6 18255414 missense probably benign 0.00
R5288:Cftr UTSW 6 18226129 nonsense probably null
R5337:Cftr UTSW 6 18319059 missense probably damaging 1.00
R5549:Cftr UTSW 6 18227954 missense probably benign 0.00
R5651:Cftr UTSW 6 18255365 splice site probably null
R5660:Cftr UTSW 6 18313687 missense probably benign 0.22
R5941:Cftr UTSW 6 18313646 missense probably damaging 1.00
R6221:Cftr UTSW 6 18282501 missense probably benign 0.00
R6222:Cftr UTSW 6 18282501 missense probably benign 0.00
R6229:Cftr UTSW 6 18220684 missense probably damaging 1.00
R6256:Cftr UTSW 6 18274661 missense probably damaging 0.96
R6257:Cftr UTSW 6 18282501 missense probably benign 0.00
R6412:Cftr UTSW 6 18285604 missense probably damaging 0.97
R6459:Cftr UTSW 6 18258236 missense probably damaging 1.00
R6558:Cftr UTSW 6 18222528 missense probably damaging 1.00
R6724:Cftr UTSW 6 18255974 nonsense probably null
R6787:Cftr UTSW 6 18274608 nonsense probably null
R6861:Cftr UTSW 6 18268108 missense probably benign 0.00
R6888:Cftr UTSW 6 18313730 critical splice donor site probably null
R7084:Cftr UTSW 6 18226138 missense probably benign 0.17
R7105:Cftr UTSW 6 18318972 missense probably damaging 1.00
R7320:Cftr UTSW 6 18319013 missense probably damaging 0.97
R7359:Cftr UTSW 6 18221624 missense probably benign 0.00
R7466:Cftr UTSW 6 18227973 missense probably benign
R7502:Cftr UTSW 6 18214296 missense probably damaging 1.00
R7748:Cftr UTSW 6 18277889 critical splice donor site probably null
R7808:Cftr UTSW 6 18204205 missense probably benign
R7817:Cftr UTSW 6 18267968 missense probably damaging 0.97
R7995:Cftr UTSW 6 18214156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGTTCGAAACTCATGGGG -3'
(R):5'- TGGGTGTGAACGTCATCAG -3'

Sequencing Primer
(F):5'- GTTCGAAACTCATGGGGTATGATAC -3'
(R):5'- GATCCAAAACAGACTGTCTTCTTCTG -3'
Posted On2016-10-26