Incidental Mutation 'R5596:Lmntd1'
ID437830
Institutional Source Beutler Lab
Gene Symbol Lmntd1
Ensembl Gene ENSMUSG00000054966
Gene Namelamin tail domain containing 1
SynonymsIfltd1, 4933403M22Rik, Lmna-rs1
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location145365134-145614319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145413414 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 191 (T191S)
Ref Sequence ENSEMBL: ENSMUSP00000120740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111706] [ENSMUST00000111708] [ENSMUST00000148739]
Predicted Effect probably benign
Transcript: ENSMUST00000111706
AA Change: T287S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107335
Gene: ENSMUSG00000054966
AA Change: T287S

DomainStartEndE-ValueType
Pfam:LTD 121 240 1.1e-18 PFAM
low complexity region 324 340 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111708
AA Change: T337S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107337
Gene: ENSMUSG00000054966
AA Change: T337S

DomainStartEndE-ValueType
Pfam:LTD 174 287 1.6e-12 PFAM
low complexity region 374 390 N/A INTRINSIC
low complexity region 394 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148739
AA Change: T191S

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120740
Gene: ENSMUSG00000054966
AA Change: T191S

DomainStartEndE-ValueType
Pfam:LTD 24 144 1.2e-18 PFAM
low complexity region 228 244 N/A INTRINSIC
low complexity region 248 266 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Lmntd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Lmntd1 APN 6 145433722 missense possibly damaging 0.92
IGL01986:Lmntd1 APN 6 145419807 missense probably damaging 1.00
IGL02064:Lmntd1 APN 6 145427276 splice site probably null
IGL02430:Lmntd1 APN 6 145413414 missense probably benign 0.34
IGL03296:Lmntd1 APN 6 145413477 missense probably benign 0.23
PIT4514001:Lmntd1 UTSW 6 145427253 frame shift probably null
R0022:Lmntd1 UTSW 6 145429990 missense probably benign 0.06
R0050:Lmntd1 UTSW 6 145417476 missense probably damaging 1.00
R0084:Lmntd1 UTSW 6 145404528 missense unknown
R0631:Lmntd1 UTSW 6 145430000 missense probably benign 0.00
R1716:Lmntd1 UTSW 6 145419874 missense probably damaging 1.00
R1850:Lmntd1 UTSW 6 145413480 missense probably benign 0.06
R3898:Lmntd1 UTSW 6 145413426 missense probably benign 0.16
R4411:Lmntd1 UTSW 6 145427277 critical splice donor site probably null
R5944:Lmntd1 UTSW 6 145427316 missense probably damaging 0.99
R6711:Lmntd1 UTSW 6 145543502 missense probably benign 0.04
R7369:Lmntd1 UTSW 6 145413575 missense probably damaging 1.00
R7445:Lmntd1 UTSW 6 145429967 missense probably damaging 0.96
R7725:Lmntd1 UTSW 6 145543470 missense probably benign 0.10
R8237:Lmntd1 UTSW 6 145427420 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGAGGCAGAGCATTCATTG -3'
(R):5'- TGAGAACTCTCTCCATTCCTATTAGG -3'

Sequencing Primer
(F):5'- GCGTCCCAAGCATTTACTTAAAGAG -3'
(R):5'- TCCATTCCTATTAGGCCATTGC -3'
Posted On2016-10-26