Incidental Mutation 'R5596:Vwa5a'
ID437836
Institutional Source Beutler Lab
Gene Symbol Vwa5a
Ensembl Gene ENSMUSG00000023186
Gene Namevon Willebrand factor A domain containing 5A
SynonymsLoh11cr2a, 5830475I06Rik, BCSC-1
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38718268-38743337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38722578 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 26 (I26F)
Ref Sequence ENSEMBL: ENSMUSP00000116251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001544] [ENSMUST00000118144] [ENSMUST00000129598]
Predicted Effect probably damaging
Transcript: ENSMUST00000001544
AA Change: I26F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001544
Gene: ENSMUSG00000023186
AA Change: I26F

DomainStartEndE-ValueType
VIT 1 131 2.59e-61 SMART
VWA 279 460 2.61e-12 SMART
low complexity region 615 629 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
Blast:VWA 681 713 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000118144
AA Change: I26F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113596
Gene: ENSMUSG00000023186
AA Change: I26F

DomainStartEndE-ValueType
VIT 1 131 2.59e-61 SMART
VWA 279 460 2.61e-12 SMART
low complexity region 615 629 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
Blast:VWA 681 713 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000129598
AA Change: I26F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6480 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Other mutations in Vwa5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Vwa5a APN 9 38737814 splice site probably null
IGL00966:Vwa5a APN 9 38723379 missense probably benign 0.24
IGL01597:Vwa5a APN 9 38733865 missense probably damaging 1.00
IGL01950:Vwa5a APN 9 38726970 missense probably damaging 1.00
IGL02008:Vwa5a APN 9 38737776 missense probably benign 0.08
IGL02326:Vwa5a APN 9 38737956 missense probably benign
IGL02378:Vwa5a APN 9 38733970 missense probably benign 0.41
IGL02442:Vwa5a APN 9 38734784 missense probably benign 0.02
IGL02458:Vwa5a APN 9 38726963 missense possibly damaging 0.79
IGL02570:Vwa5a APN 9 38734871 unclassified probably benign
IGL03068:Vwa5a APN 9 38734847 missense probably benign 0.45
R0126:Vwa5a UTSW 9 38737807 splice site probably null
R0325:Vwa5a UTSW 9 38728665 missense probably damaging 1.00
R0617:Vwa5a UTSW 9 38723895 missense probably damaging 1.00
R0928:Vwa5a UTSW 9 38728007 missense probably damaging 1.00
R1334:Vwa5a UTSW 9 38734741 missense probably benign 0.01
R1446:Vwa5a UTSW 9 38733968 missense possibly damaging 0.95
R1708:Vwa5a UTSW 9 38727832 missense probably benign
R1986:Vwa5a UTSW 9 38737814 splice site probably benign
R2024:Vwa5a UTSW 9 38736061 missense probably damaging 0.98
R2230:Vwa5a UTSW 9 38733878 missense probably null 1.00
R2252:Vwa5a UTSW 9 38728080 missense probably damaging 1.00
R2278:Vwa5a UTSW 9 38723207 missense probably damaging 1.00
R3912:Vwa5a UTSW 9 38734743 missense probably damaging 0.97
R3913:Vwa5a UTSW 9 38734743 missense probably damaging 0.97
R4172:Vwa5a UTSW 9 38723870 missense probably damaging 0.98
R4244:Vwa5a UTSW 9 38737816 splice site probably benign
R4510:Vwa5a UTSW 9 38722557 missense possibly damaging 0.60
R4511:Vwa5a UTSW 9 38722557 missense possibly damaging 0.60
R4549:Vwa5a UTSW 9 38737925 missense probably benign 0.09
R4591:Vwa5a UTSW 9 38735620 missense possibly damaging 0.94
R4639:Vwa5a UTSW 9 38727114 critical splice donor site probably null
R4811:Vwa5a UTSW 9 38735953 missense probably benign 0.00
R4911:Vwa5a UTSW 9 38737972 missense probably benign 0.03
R4936:Vwa5a UTSW 9 38736198 missense probably benign 0.00
R4989:Vwa5a UTSW 9 38722630 missense probably benign 0.40
R5370:Vwa5a UTSW 9 38741216 missense probably benign 0.02
R5914:Vwa5a UTSW 9 38741742 missense probably benign 0.00
R6207:Vwa5a UTSW 9 38722672 missense probably damaging 1.00
R6486:Vwa5a UTSW 9 38733878 missense probably null 1.00
R7666:Vwa5a UTSW 9 38733963 missense probably benign 0.06
R7683:Vwa5a UTSW 9 38734829 missense probably damaging 1.00
R7763:Vwa5a UTSW 9 38741162 missense possibly damaging 0.93
R7839:Vwa5a UTSW 9 38723503 missense probably damaging 0.98
R7922:Vwa5a UTSW 9 38723503 missense probably damaging 0.98
R7996:Vwa5a UTSW 9 38727828 nonsense probably null
R8024:Vwa5a UTSW 9 38736020 nonsense probably null
X0022:Vwa5a UTSW 9 38735962 missense probably damaging 1.00
X0067:Vwa5a UTSW 9 38723251 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATGGAGCATCACTGTGGTC -3'
(R):5'- AGAACAGGCAATATCAGCACTTATG -3'

Sequencing Primer
(F):5'- GGAGCATCACTGTGGTCTAATCAC -3'
(R):5'- CAGGCAATATCAGCACTTATGAATTG -3'
Posted On2016-10-26