Incidental Mutation 'R5596:Pbld2'
ID437839
Institutional Source Beutler Lab
Gene Symbol Pbld2
Ensembl Gene ENSMUSG00000020072
Gene Namephenazine biosynthesis-like protein domain containing 2
Synonyms3110049J23Rik
MMRRC Submission 043148-MU
Accession Numbers

Genbank: NM_026085 ; MGI: 1914557

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63024315-63058813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63072012 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 219 (A219V)
Ref Sequence ENSEMBL: ENSMUSP00000136589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020266] [ENSMUST00000178684]
Predicted Effect probably damaging
Transcript: ENSMUST00000020266
AA Change: A220V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020266
Gene: ENSMUSG00000112129
AA Change: A220V

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 8 285 7e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178684
AA Change: A219V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136589
Gene: ENSMUSG00000112129
AA Change: A219V

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 8 284 2.6e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218358
Predicted Effect unknown
Transcript: ENSMUST00000219829
AA Change: A112V
Meta Mutation Damage Score 0.6102 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Pbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Pbld2 APN 10 63071955 missense probably benign 0.01
IGL02162:Pbld2 APN 10 63071400 splice site probably benign
IGL03206:Pbld2 APN 10 63047482 missense probably benign 0.06
R0311:Pbld2 UTSW 10 63054507 critical splice donor site probably null
R0366:Pbld2 UTSW 10 63053957 unclassified probably benign
R0727:Pbld2 UTSW 10 63067519 missense probably benign 0.03
R0731:Pbld2 UTSW 10 63056811 missense probably damaging 1.00
R1412:Pbld2 UTSW 10 63047522 missense probably damaging 1.00
R1523:Pbld2 UTSW 10 63076433 missense probably benign 0.01
R1531:Pbld2 UTSW 10 63053953 critical splice donor site probably null
R1773:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1778:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1797:Pbld2 UTSW 10 63075124 critical splice donor site probably null
R2251:Pbld2 UTSW 10 63024605 unclassified probably benign
R3036:Pbld2 UTSW 10 63071446 missense probably damaging 1.00
R3117:Pbld2 UTSW 10 63054436 missense probably benign 0.00
R3622:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3624:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3734:Pbld2 UTSW 10 63071465 missense probably damaging 1.00
R4260:Pbld2 UTSW 10 63024407 unclassified probably benign
R4684:Pbld2 UTSW 10 63057697 missense probably damaging 1.00
R4928:Pbld2 UTSW 10 63047999 missense probably damaging 1.00
R4936:Pbld2 UTSW 10 63052238 missense probably damaging 1.00
R5508:Pbld2 UTSW 10 63066665 unclassified probably null
R5603:Pbld2 UTSW 10 63071449 missense probably benign
R6298:Pbld2 UTSW 10 63039152 missense probably benign 0.05
R6404:Pbld2 UTSW 10 63054328 missense probably damaging 0.98
R7089:Pbld2 UTSW 10 63053912 missense probably benign 0.23
R7134:Pbld2 UTSW 10 63024589 unclassified probably benign
R7423:Pbld2 UTSW 10 63048004 missense probably damaging 1.00
R8016:Pbld2 UTSW 10 63047965 missense probably damaging 1.00
R8039:Pbld2 UTSW 10 63047992 missense probably damaging 1.00
YA93:Pbld2 UTSW 10 63054445 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GATGCTGATTCCTAACCCATCC -3'
(R):5'- CAGCAATGTCAGAGAAGGCC -3'

Sequencing Primer
(F):5'- AACCCATCCTGTTTGTGCTCAAG -3'
(R):5'- ACTTGAGCTCCCAGTTGAAG -3'
Posted On2016-10-26