Incidental Mutation 'R5596:Creb3l3'
ID437840
Institutional Source Beutler Lab
Gene Symbol Creb3l3
Ensembl Gene ENSMUSG00000035041
Gene NamecAMP responsive element binding protein 3-like 3
SynonymsD10Bur1e, CREB-H
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81084324-81098874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 81085047 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 383 (D383A)
Ref Sequence ENSEMBL: ENSMUSP00000112836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005057] [ENSMUST00000117422]
Predicted Effect probably benign
Transcript: ENSMUST00000005057
SMART Domains Protein: ENSMUSP00000005057
Gene: ENSMUSG00000004929

DomainStartEndE-ValueType
Pfam:Peptidase_M3 227 677 7e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117422
AA Change: D383A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112836
Gene: ENSMUSG00000035041
AA Change: D383A

DomainStartEndE-ValueType
low complexity region 179 199 N/A INTRINSIC
BRLZ 237 301 4.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166404
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-leucine zipper family and the AMP-dependent transcription factor family. The encoded protein is localized to the endoplasmic reticulum and acts as a transcription factor activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and the box-B element and has been linked to acute inflammatory response, hepatocellular carcinoma, triglyceride metabolism, and hepcidin expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and healthy but exhibit reduced expression of acute phase response proteins following treatment with tunicamycin that induces ER stress. Mice homozygous for a different knock-out allele exhibit resistanceto sulpyrine-induced shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Creb3l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Creb3l3 APN 10 81091276 missense probably benign
IGL02651:Creb3l3 APN 10 81084834 missense probably benign 0.03
IGL03093:Creb3l3 APN 10 81091213 missense probably benign 0.00
PIT4382001:Creb3l3 UTSW 10 81084912 missense probably benign 0.01
R0501:Creb3l3 UTSW 10 81086582 missense probably benign 0.29
R2421:Creb3l3 UTSW 10 81091818 missense probably benign 0.01
R2567:Creb3l3 UTSW 10 81086049 missense probably benign 0.00
R4038:Creb3l3 UTSW 10 81089338 missense probably benign 0.15
R4748:Creb3l3 UTSW 10 81086047 missense probably benign 0.00
R5814:Creb3l3 UTSW 10 81085662 missense probably benign 0.01
R5889:Creb3l3 UTSW 10 81092533 utr 5 prime probably benign
R6135:Creb3l3 UTSW 10 81085718 missense probably benign 0.20
R6299:Creb3l3 UTSW 10 81088613 missense probably damaging 1.00
R6721:Creb3l3 UTSW 10 81091143 missense probably damaging 0.96
R7472:Creb3l3 UTSW 10 81089467 intron probably null
R7761:Creb3l3 UTSW 10 81084999 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CTGAGCAGTGGTTCTGAAGC -3'
(R):5'- TGAGTGTCACACAACCCAGG -3'

Sequencing Primer
(F):5'- TGGTTCTGAAGCCACCCAGTC -3'
(R):5'- AGGGGACACAGTTGCCACTAC -3'
Posted On2016-10-26