Incidental Mutation 'R5596:Omd'
ID437842
Institutional Source Beutler Lab
Gene Symbol Omd
Ensembl Gene ENSMUSG00000048368
Gene Nameosteomodulin
Synonymsosteoadherin, OSAD, SLRR2C
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49582462-49592822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49592338 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 408 (H408R)
Ref Sequence ENSEMBL: ENSMUSP00000152066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000065494] [ENSMUST00000221170]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065494
AA Change: H408R

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000065706
Gene: ENSMUSG00000048368
AA Change: H408R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 61 95 3.14e-11 SMART
LRR 115 139 2.15e2 SMART
LRR 140 160 2.2e1 SMART
LRR 162 184 4.21e1 SMART
LRR 185 210 1.01e2 SMART
LRR 211 234 6.96e0 SMART
LRR 235 255 8.49e1 SMART
LRR 256 279 1.76e-1 SMART
LRR 300 322 7.8e1 SMART
Blast:LRR 330 353 6e-8 BLAST
low complexity region 385 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221170
AA Change: H408R

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221751
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired cued contextual conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Omd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Omd APN 13 49589643 nonsense probably null
IGL01982:Omd APN 13 49589497 missense possibly damaging 0.88
IGL02678:Omd APN 13 49592281 missense probably benign 0.37
IGL03069:Omd APN 13 49592394 utr 3 prime probably benign
R1036:Omd UTSW 13 49589971 missense probably damaging 1.00
R3954:Omd UTSW 13 49589737 missense probably benign 0.00
R4030:Omd UTSW 13 49589649 missense probably benign 0.08
R4335:Omd UTSW 13 49590236 missense probably benign 0.02
R5095:Omd UTSW 13 49589698 missense possibly damaging 0.95
R5137:Omd UTSW 13 49590076 missense probably benign 0.05
R5400:Omd UTSW 13 49592227 missense probably benign 0.37
R5930:Omd UTSW 13 49589636 missense possibly damaging 0.63
R6132:Omd UTSW 13 49590367 missense probably damaging 0.97
R6294:Omd UTSW 13 49589991 missense probably damaging 1.00
R6454:Omd UTSW 13 49589869 missense probably damaging 0.99
R6680:Omd UTSW 13 49589528 missense possibly damaging 0.74
R6704:Omd UTSW 13 49589873 missense probably damaging 1.00
R6932:Omd UTSW 13 49590234 missense probably damaging 1.00
R7427:Omd UTSW 13 49592269 missense possibly damaging 0.68
R7884:Omd UTSW 13 49590154 missense probably damaging 1.00
R7967:Omd UTSW 13 49590154 missense probably damaging 1.00
R8129:Omd UTSW 13 49592089 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAACATACCTTCGTGTGGACC -3'
(R):5'- CACCAACATCTTAAATGCAGTTCTG -3'

Sequencing Primer
(F):5'- CCTTCGTGTGGACCAAAATAAGCTG -3'
(R):5'- TGCAGTTCTGATCTTTATACTAACAC -3'
Posted On2016-10-26