Incidental Mutation 'R5597:Lamc1'
ID 437852
Institutional Source Beutler Lab
Gene Symbol Lamc1
Ensembl Gene ENSMUSG00000026478
Gene Name laminin, gamma 1
Synonyms laminin B2, Lamb2
MMRRC Submission 043149-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5597 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 153094668-153208532 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 153127716 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 396 (C396R)
Ref Sequence ENSEMBL: ENSMUSP00000027752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027752]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027752
AA Change: C396R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: C396R

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LamNT 42 282 1.97e-150 SMART
EGF_Lam 284 337 7.18e-7 SMART
EGF_Lam 340 393 7.93e-9 SMART
EGF_Lam 396 440 2.11e-13 SMART
EGF_Lam 443 490 2.87e-15 SMART
LamB 551 676 5.52e-48 SMART
Pfam:Laminin_EGF 683 718 1.3e-4 PFAM
EGF_Lam 722 768 2.38e-12 SMART
EGF_Lam 771 823 1.39e-4 SMART
EGF_Lam 826 879 8.05e-10 SMART
EGF_Lam 882 930 8.9e-12 SMART
EGF_Lam 933 978 1.26e-11 SMART
EGF_Lam 981 1026 7.4e-9 SMART
coiled coil region 1063 1594 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159251
Meta Mutation Damage Score 0.9743 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 109,927,363 (GRCm39) T1330I probably damaging Het
Aebp1 T C 11: 5,816,487 (GRCm39) V322A probably benign Het
Anks3 T A 16: 4,771,793 (GRCm39) H77L possibly damaging Het
Bsn A T 9: 107,992,131 (GRCm39) M1207K probably benign Het
Btla A G 16: 45,064,599 (GRCm39) T183A probably benign Het
Cdca8 G A 4: 124,812,793 (GRCm39) R286W probably damaging Het
Cnot6l T C 5: 96,278,978 (GRCm39) D80G probably damaging Het
Col16a1 A G 4: 129,952,097 (GRCm39) D93G probably damaging Het
Ctsk T C 3: 95,409,007 (GRCm39) V130A probably damaging Het
Cul9 T C 17: 46,813,591 (GRCm39) E2294G possibly damaging Het
Dcaf5 G T 12: 80,386,817 (GRCm39) S436R probably damaging Het
Dnah7a A T 1: 53,573,611 (GRCm39) L1792H probably benign Het
Dst T C 1: 34,231,794 (GRCm39) V3307A probably benign Het
Frrs1 C T 3: 116,671,887 (GRCm39) probably benign Het
Gimap4 T C 6: 48,667,698 (GRCm39) L151P probably damaging Het
Hook2 A G 8: 85,720,657 (GRCm39) N166S probably benign Het
Hp1bp3 A T 4: 137,948,939 (GRCm39) M1L possibly damaging Het
Igkv4-56 T A 6: 69,564,467 (GRCm39) noncoding transcript Het
Kdm6b C T 11: 69,296,900 (GRCm39) A456T probably damaging Het
Lars2 A T 9: 123,284,047 (GRCm39) D745V probably damaging Het
Macf1 A T 4: 123,433,570 (GRCm39) probably benign Het
Mapk4 T A 18: 74,070,341 (GRCm39) Y184F probably benign Het
Mgat5 A G 1: 127,325,303 (GRCm39) Y390C probably damaging Het
Msh2 T C 17: 88,030,789 (GRCm39) S889P probably benign Het
Nebl A G 2: 17,382,978 (GRCm39) S100P probably benign Het
Nudt7 A T 8: 114,878,506 (GRCm39) H154L probably benign Het
Olig2 A T 16: 91,023,768 (GRCm39) M161L probably benign Het
Or2ah1 T C 2: 85,653,804 (GRCm39) L163P probably damaging Het
Or5h24 A T 16: 58,918,710 (GRCm39) V215D unknown Het
Or6c214 T C 10: 129,590,755 (GRCm39) D188G probably damaging Het
Palmd T A 3: 116,717,225 (GRCm39) D424V probably damaging Het
Pdzk1ip1 A G 4: 114,950,689 (GRCm39) N164D probably damaging Het
Prkag1 A G 15: 98,713,789 (GRCm39) S14P probably damaging Het
Prss12 C T 3: 123,258,389 (GRCm39) P161L probably benign Het
Pwwp2a T C 11: 43,573,422 (GRCm39) V168A probably benign Het
Rassf7 A G 7: 140,797,024 (GRCm39) D79G probably damaging Het
Rgs3 A T 4: 62,542,082 (GRCm39) I19F probably damaging Het
Slc30a10 C A 1: 185,194,897 (GRCm39) H236Q probably damaging Het
Slco3a1 C A 7: 73,934,210 (GRCm39) R654L probably benign Het
Smad4 A C 18: 73,795,898 (GRCm39) F165L probably benign Het
Swsap1 G T 9: 21,867,242 (GRCm39) R62M probably damaging Het
Tenm4 T A 7: 96,202,724 (GRCm39) M113K probably benign Het
Tmem225 A G 9: 40,060,726 (GRCm39) N95S possibly damaging Het
Tnni3k A T 3: 154,577,765 (GRCm39) L658H probably damaging Het
Trem2 G A 17: 48,658,840 (GRCm39) V202I probably benign Het
Tyw1 C T 5: 130,303,498 (GRCm39) L289F probably benign Het
Vcam1 T A 3: 115,919,651 (GRCm39) D205V probably damaging Het
Vmn2r-ps158 A G 7: 42,674,073 (GRCm39) D377G probably benign Het
Yy1 A G 12: 108,781,436 (GRCm39) D367G probably damaging Het
Zfp11 A T 5: 129,734,166 (GRCm39) C432S probably benign Het
Other mutations in Lamc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Lamc1 APN 1 153,116,241 (GRCm39) missense probably damaging 1.00
IGL01397:Lamc1 APN 1 153,126,880 (GRCm39) missense probably damaging 1.00
IGL01661:Lamc1 APN 1 153,097,319 (GRCm39) missense possibly damaging 0.89
IGL01894:Lamc1 APN 1 153,122,828 (GRCm39) missense possibly damaging 0.51
IGL02000:Lamc1 APN 1 153,116,179 (GRCm39) missense probably damaging 1.00
IGL02649:Lamc1 APN 1 153,122,788 (GRCm39) missense possibly damaging 0.78
IGL02749:Lamc1 APN 1 153,125,599 (GRCm39) missense possibly damaging 0.51
IGL02819:Lamc1 APN 1 153,126,407 (GRCm39) missense probably damaging 1.00
IGL02831:Lamc1 APN 1 153,122,801 (GRCm39) missense probably benign 0.00
IGL03069:Lamc1 APN 1 153,115,127 (GRCm39) missense probably damaging 1.00
IGL03143:Lamc1 APN 1 153,208,020 (GRCm39) missense probably benign 0.00
IGL03166:Lamc1 APN 1 153,208,047 (GRCm39) missense probably benign 0.01
IGL03285:Lamc1 APN 1 153,103,431 (GRCm39) missense possibly damaging 0.96
IGL03294:Lamc1 APN 1 153,138,392 (GRCm39) missense probably damaging 1.00
pride UTSW 1 153,123,030 (GRCm39) missense probably benign 0.01
Stratum UTSW 1 153,126,870 (GRCm39) nonsense probably null
tier UTSW 1 153,126,268 (GRCm39) missense probably damaging 1.00
PIT4280001:Lamc1 UTSW 1 153,119,217 (GRCm39) missense probably damaging 1.00
R0003:Lamc1 UTSW 1 153,138,185 (GRCm39) missense probably damaging 0.99
R0003:Lamc1 UTSW 1 153,138,185 (GRCm39) missense probably damaging 0.99
R0027:Lamc1 UTSW 1 153,138,329 (GRCm39) missense probably damaging 1.00
R0060:Lamc1 UTSW 1 153,117,614 (GRCm39) unclassified probably benign
R0078:Lamc1 UTSW 1 153,104,936 (GRCm39) missense probably damaging 0.96
R0157:Lamc1 UTSW 1 153,138,353 (GRCm39) missense probably benign 0.00
R0282:Lamc1 UTSW 1 153,131,058 (GRCm39) missense probably benign
R0374:Lamc1 UTSW 1 153,126,811 (GRCm39) splice site probably benign
R0494:Lamc1 UTSW 1 153,122,682 (GRCm39) critical splice donor site probably null
R0502:Lamc1 UTSW 1 153,122,678 (GRCm39) splice site probably benign
R0755:Lamc1 UTSW 1 153,123,196 (GRCm39) missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153,110,341 (GRCm39) missense probably damaging 1.00
R0791:Lamc1 UTSW 1 153,110,326 (GRCm39) missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153,110,358 (GRCm39) missense probably benign 0.01
R0792:Lamc1 UTSW 1 153,110,326 (GRCm39) missense possibly damaging 0.94
R0792:Lamc1 UTSW 1 153,110,341 (GRCm39) missense probably damaging 1.00
R0792:Lamc1 UTSW 1 153,110,358 (GRCm39) missense probably benign 0.01
R0892:Lamc1 UTSW 1 153,208,000 (GRCm39) missense possibly damaging 0.95
R0941:Lamc1 UTSW 1 153,208,020 (GRCm39) missense possibly damaging 0.72
R0961:Lamc1 UTSW 1 153,097,446 (GRCm39) missense probably benign 0.03
R0961:Lamc1 UTSW 1 153,097,392 (GRCm39) frame shift probably null
R0963:Lamc1 UTSW 1 153,119,132 (GRCm39) missense probably benign
R1127:Lamc1 UTSW 1 153,126,205 (GRCm39) missense possibly damaging 0.69
R1173:Lamc1 UTSW 1 153,122,977 (GRCm39) splice site probably benign
R1175:Lamc1 UTSW 1 153,122,977 (GRCm39) splice site probably benign
R1449:Lamc1 UTSW 1 153,126,241 (GRCm39) missense probably benign
R1481:Lamc1 UTSW 1 153,097,380 (GRCm39) missense probably damaging 1.00
R1565:Lamc1 UTSW 1 153,118,489 (GRCm39) missense probably benign 0.34
R1583:Lamc1 UTSW 1 153,119,224 (GRCm39) critical splice acceptor site probably null
R1643:Lamc1 UTSW 1 153,133,818 (GRCm39) splice site probably benign
R1652:Lamc1 UTSW 1 153,125,392 (GRCm39) missense probably damaging 1.00
R1691:Lamc1 UTSW 1 153,122,995 (GRCm39) missense probably benign 0.04
R1854:Lamc1 UTSW 1 153,125,618 (GRCm39) missense probably damaging 0.99
R2018:Lamc1 UTSW 1 153,118,378 (GRCm39) missense probably benign 0.07
R2170:Lamc1 UTSW 1 153,124,888 (GRCm39) missense probably benign 0.07
R2410:Lamc1 UTSW 1 153,123,141 (GRCm39) missense possibly damaging 0.61
R3438:Lamc1 UTSW 1 153,102,161 (GRCm39) missense probably benign 0.04
R3615:Lamc1 UTSW 1 153,126,896 (GRCm39) missense probably damaging 1.00
R3616:Lamc1 UTSW 1 153,126,896 (GRCm39) missense probably damaging 1.00
R3699:Lamc1 UTSW 1 153,130,951 (GRCm39) missense possibly damaging 0.79
R3811:Lamc1 UTSW 1 153,138,454 (GRCm39) splice site probably null
R4285:Lamc1 UTSW 1 153,110,298 (GRCm39) missense probably damaging 0.99
R4431:Lamc1 UTSW 1 153,097,274 (GRCm39) missense probably damaging 1.00
R4579:Lamc1 UTSW 1 153,123,015 (GRCm39) missense probably damaging 1.00
R4625:Lamc1 UTSW 1 153,118,442 (GRCm39) missense probably benign 0.04
R4649:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4650:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4651:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4652:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4653:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4784:Lamc1 UTSW 1 153,107,486 (GRCm39) missense probably damaging 1.00
R4785:Lamc1 UTSW 1 153,107,486 (GRCm39) missense probably damaging 1.00
R4853:Lamc1 UTSW 1 153,104,846 (GRCm39) missense possibly damaging 0.89
R5216:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5217:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5218:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5219:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5468:Lamc1 UTSW 1 153,109,310 (GRCm39) missense probably damaging 0.99
R5754:Lamc1 UTSW 1 153,123,030 (GRCm39) missense probably benign 0.01
R6233:Lamc1 UTSW 1 153,099,412 (GRCm39) missense probably benign
R6431:Lamc1 UTSW 1 153,097,417 (GRCm39) missense probably benign 0.21
R6636:Lamc1 UTSW 1 153,117,721 (GRCm39) missense possibly damaging 0.93
R6888:Lamc1 UTSW 1 153,138,238 (GRCm39) missense probably damaging 1.00
R7161:Lamc1 UTSW 1 153,102,200 (GRCm39) missense probably damaging 1.00
R7240:Lamc1 UTSW 1 153,110,396 (GRCm39) missense possibly damaging 0.82
R7388:Lamc1 UTSW 1 153,124,822 (GRCm39) missense probably damaging 1.00
R7474:Lamc1 UTSW 1 153,208,011 (GRCm39) missense possibly damaging 0.81
R7570:Lamc1 UTSW 1 153,119,021 (GRCm39) missense possibly damaging 0.64
R7583:Lamc1 UTSW 1 153,118,978 (GRCm39) missense possibly damaging 0.71
R7597:Lamc1 UTSW 1 153,116,200 (GRCm39) missense possibly damaging 0.94
R7635:Lamc1 UTSW 1 153,124,806 (GRCm39) missense probably damaging 1.00
R7976:Lamc1 UTSW 1 153,123,014 (GRCm39) missense probably damaging 1.00
R8012:Lamc1 UTSW 1 153,097,358 (GRCm39) missense probably benign 0.04
R8207:Lamc1 UTSW 1 153,126,268 (GRCm39) missense probably damaging 1.00
R8219:Lamc1 UTSW 1 153,123,073 (GRCm39) missense probably damaging 1.00
R8227:Lamc1 UTSW 1 153,099,500 (GRCm39) missense probably benign 0.04
R8315:Lamc1 UTSW 1 153,119,167 (GRCm39) missense probably benign 0.00
R8417:Lamc1 UTSW 1 153,106,515 (GRCm39) missense probably damaging 1.00
R8685:Lamc1 UTSW 1 153,109,288 (GRCm39) missense probably benign 0.31
R8827:Lamc1 UTSW 1 153,097,424 (GRCm39) missense probably damaging 1.00
R8995:Lamc1 UTSW 1 153,207,993 (GRCm39) missense probably benign 0.00
R9061:Lamc1 UTSW 1 153,126,870 (GRCm39) nonsense probably null
R9141:Lamc1 UTSW 1 153,123,196 (GRCm39) missense probably benign 0.01
R9187:Lamc1 UTSW 1 153,097,434 (GRCm39) nonsense probably null
R9206:Lamc1 UTSW 1 153,126,197 (GRCm39) missense probably damaging 1.00
R9222:Lamc1 UTSW 1 153,119,087 (GRCm39) missense probably damaging 0.96
R9297:Lamc1 UTSW 1 153,127,746 (GRCm39) missense probably damaging 1.00
R9318:Lamc1 UTSW 1 153,127,746 (GRCm39) missense probably damaging 1.00
R9377:Lamc1 UTSW 1 153,115,009 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCCAATTATTTACAGAACTGCTCC -3'
(R):5'- TGTGACTGCAATGGCCGATC -3'

Sequencing Primer
(F):5'- TTCAACTTAGCATGAAGGAGGC -3'
(R):5'- GATCCCAAGAGTGCTACTTTGATC -3'
Posted On 2016-10-26