Incidental Mutation 'R5597:Slc30a10'
ID437853
Institutional Source Beutler Lab
Gene Symbol Slc30a10
Ensembl Gene ENSMUSG00000026614
Gene Namesolute carrier family 30, member 10
Synonyms
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5597 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location185454848-185468762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 185462700 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 236 (H236Q)
Ref Sequence ENSEMBL: ENSMUSP00000053181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061093]
Predicted Effect probably damaging
Transcript: ENSMUST00000061093
AA Change: H236Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053181
Gene: ENSMUSG00000026614
AA Change: H236Q

DomainStartEndE-ValueType
Pfam:Cation_efflux 11 299 2e-44 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly expressed in the liver and is inducible by manganese. Its protein product appears to be critical in maintaining manganese levels, and has higher specificity for manganese than zinc. Loss of function mutations appear to result in a pleomorphic phenotype, including dystonia and adult-onset parkinsonism. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit post-weaning growth defects, increased manganese levels in the brain, blood, liver and thyroid gland, severe hypothyroidism and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Slc30a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Slc30a10 APN 1 185455419 missense probably damaging 1.00
IGL01779:Slc30a10 APN 1 185464179 missense possibly damaging 0.94
IGL01906:Slc30a10 APN 1 185456396 nonsense probably null
IGL02024:Slc30a10 APN 1 185455241 missense possibly damaging 0.94
R0111:Slc30a10 UTSW 1 185455547 missense probably benign
R0133:Slc30a10 UTSW 1 185455173 missense probably damaging 1.00
R1886:Slc30a10 UTSW 1 185462864 missense probably damaging 1.00
R3915:Slc30a10 UTSW 1 185455136 nonsense probably null
R6175:Slc30a10 UTSW 1 185455311 missense probably damaging 1.00
R6669:Slc30a10 UTSW 1 185464428 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACATTGCTCTGACCTGTG -3'
(R):5'- TTTGATCAGTGGGAAAGCTGAC -3'

Sequencing Primer
(F):5'- AAGATGGTCTCACTATGTAGCTTAGG -3'
(R):5'- CTGACGATAAGATAATGATGACCATG -3'
Posted On2016-10-26