Incidental Mutation 'R5597:Nebl'
ID437855
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Namenebulette
SynonymsLnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5597 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location17343909-17731464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17378167 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 100 (S100P)
Ref Sequence ENSEMBL: ENSMUSP00000137567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000177966]
Predicted Effect probably benign
Transcript: ENSMUST00000028080
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124270
AA Change: S697P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: S697P

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124611
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150194
Predicted Effect probably benign
Transcript: ENSMUST00000177966
AA Change: S100P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137567
Gene: ENSMUSG00000053702
AA Change: S100P

DomainStartEndE-ValueType
NEBU 5 35 2.23e-4 SMART
NEBU 36 66 3.28e-2 SMART
NEBU 67 97 6.6e-7 SMART
NEBU 98 120 2e1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0128:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2062:Nebl UTSW 2 17397121 missense probably benign 0.39
R2183:Nebl UTSW 2 17404216 missense probably damaging 0.99
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2679:Nebl UTSW 2 17424591 missense probably benign 0.03
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R2878:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 unclassified probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5533:Nebl UTSW 2 17393268 nonsense probably null
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
R7196:Nebl UTSW 2 17452518 missense probably damaging 1.00
R7671:Nebl UTSW 2 17390916 nonsense probably null
R7728:Nebl UTSW 2 17370514 missense
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGCCAGTCAAATGAGACTATC -3'
(R):5'- TTCCTGACCAGTTGAGTTCAGTC -3'

Sequencing Primer
(F):5'- GGTTCTCAACCCTCATAGTAACATG -3'
(R):5'- TTCAGTCAACAGGAGACCACTGTG -3'
Posted On2016-10-26