Incidental Mutation 'R5597:Ctsk'
ID437857
Institutional Source Beutler Lab
Gene Symbol Ctsk
Ensembl Gene ENSMUSG00000028111
Gene Namecathepsin K
SynonymsCat K, catK
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5597 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95499256-95509362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95501696 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 130 (V130A)
Ref Sequence ENSEMBL: ENSMUSP00000015664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015664] [ENSMUST00000090804] [ENSMUST00000107161]
Predicted Effect probably damaging
Transcript: ENSMUST00000015664
AA Change: V130A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015664
Gene: ENSMUSG00000028111
AA Change: V130A

DomainStartEndE-ValueType
Inhibitor_I29 26 86 1.48e-22 SMART
Pept_C1 115 328 4.25e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090804
SMART Domains Protein: ENSMUSP00000088313
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 710 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107161
SMART Domains Protein: ENSMUSP00000102779
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 694 707 N/A INTRINSIC
Meta Mutation Damage Score 0.7919 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a member of the cathepsin family of cysteine proteases that is highly expressed in osteoclasts and is involved in the degradation of collagen and other matrix proteins in bone. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional enzyme. Mice lacking the encoded protein exhibit phenotypic features of pycnodysostosis such as increased bone density and bone deformity, which become progressively more pronounced with age. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene survive well and are fertile. They have osteopetrosis, reduced levels of thyroxine and increased pulmonary fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Ctsk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Ctsk APN 3 95501419 missense possibly damaging 0.73
R0255:Ctsk UTSW 3 95508877 missense probably benign 0.00
R0362:Ctsk UTSW 3 95500944 missense probably damaging 1.00
R1241:Ctsk UTSW 3 95500874 missense probably benign
R2014:Ctsk UTSW 3 95506692 missense probably damaging 1.00
R2110:Ctsk UTSW 3 95506677 missense probably benign 0.35
R5990:Ctsk UTSW 3 95501456 missense probably damaging 1.00
R6363:Ctsk UTSW 3 95501551 missense probably damaging 1.00
R6754:Ctsk UTSW 3 95502685 missense probably damaging 1.00
R7142:Ctsk UTSW 3 95506948 missense possibly damaging 0.83
R7610:Ctsk UTSW 3 95500844 missense probably benign
R7670:Ctsk UTSW 3 95501614 missense probably benign 0.00
X0005:Ctsk UTSW 3 95500938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCCCTGCTAATGCTTG -3'
(R):5'- TTGAATCTTCAGCCCACAGC -3'

Sequencing Primer
(F):5'- GGCATCCTTTCTTGTCTCAGAC -3'
(R):5'- GTCAGATTACCACAGATGC -3'
Posted On2016-10-26