Incidental Mutation 'R5597:Vcam1'
ID437858
Institutional Source Beutler Lab
Gene Symbol Vcam1
Ensembl Gene ENSMUSG00000027962
Gene Namevascular cell adhesion molecule 1
SynonymsVcam-1, CD106
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R5597 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116109949-116129688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116126002 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 205 (D205V)
Ref Sequence ENSEMBL: ENSMUSP00000142876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029574] [ENSMUST00000196309] [ENSMUST00000196449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029574
AA Change: D205V

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029574
Gene: ENSMUSG00000027962
AA Change: D205V

DomainStartEndE-ValueType
IG 32 113 2.41e-6 SMART
Pfam:C2-set 133 221 4.5e-27 PFAM
IGc2 237 298 2.09e-15 SMART
IGc2 326 390 8.38e-6 SMART
Pfam:C2-set 421 509 7.2e-26 PFAM
IGc2 525 586 7.35e-11 SMART
IG 608 686 2.25e-6 SMART
transmembrane domain 699 721 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196309
AA Change: D211V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143260
Gene: ENSMUSG00000027962
AA Change: D211V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IG 38 119 1e-8 SMART
Pfam:C2-set 139 227 1.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196449
AA Change: D205V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142876
Gene: ENSMUSG00000027962
AA Change: D205V

DomainStartEndE-ValueType
IG 32 113 2.41e-6 SMART
Pfam:C2-set 133 221 1.3e-27 PFAM
IGc2 237 298 2.09e-15 SMART
transmembrane domain 322 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198269
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ig superfamily and encodes a cell surface sialoglycoprotein expressed by cytokine-activated endothelium. This type I membrane protein mediates leukocyte-endothelial cell adhesion and signal transduction, and may play a role in the development of artherosclerosis and rheumatoid arthritis. Three alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Most homozygous null mutants die by embryonic day 12.5 due to defective placenta and failure of chorion/allantois fusion, and heart developmental anomalies. Survivors are generally normal, but have high numbers of circulating blood mononuclear leukocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Vcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Vcam1 APN 3 116114471 missense possibly damaging 0.85
IGL01546:Vcam1 APN 3 116115942 missense possibly damaging 0.86
IGL01548:Vcam1 APN 3 116115951 missense probably benign 0.06
IGL02070:Vcam1 APN 3 116125997 missense probably benign 0.07
IGL02353:Vcam1 APN 3 116115894 missense possibly damaging 0.53
IGL02360:Vcam1 APN 3 116115894 missense possibly damaging 0.53
K7371:Vcam1 UTSW 3 116124649 missense probably benign 0.00
R0310:Vcam1 UTSW 3 116114416 missense possibly damaging 0.93
R0319:Vcam1 UTSW 3 116116060 missense probably benign 0.01
R0468:Vcam1 UTSW 3 116115946 nonsense probably null
R0638:Vcam1 UTSW 3 116117259 missense possibly damaging 0.71
R1070:Vcam1 UTSW 3 116110903 missense possibly damaging 0.96
R1728:Vcam1 UTSW 3 116114515 missense probably benign 0.16
R1784:Vcam1 UTSW 3 116114515 missense probably benign 0.16
R1956:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R1957:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R3052:Vcam1 UTSW 3 116124430 unclassified probably null
R3832:Vcam1 UTSW 3 116114491 missense possibly damaging 0.71
R4297:Vcam1 UTSW 3 116117243 missense probably benign
R4801:Vcam1 UTSW 3 116115935 missense probably damaging 0.98
R4802:Vcam1 UTSW 3 116115935 missense probably damaging 0.98
R4970:Vcam1 UTSW 3 116117292 missense probably benign 0.00
R5073:Vcam1 UTSW 3 116124388 missense probably damaging 1.00
R5074:Vcam1 UTSW 3 116124388 missense probably damaging 1.00
R5112:Vcam1 UTSW 3 116117292 missense probably benign 0.00
R6035:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R6035:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R6120:Vcam1 UTSW 3 116124400 missense probably damaging 0.99
R6617:Vcam1 UTSW 3 116126062 missense possibly damaging 0.48
R7232:Vcam1 UTSW 3 116125979 missense possibly damaging 0.71
R7350:Vcam1 UTSW 3 116114562 missense probably damaging 0.99
R7384:Vcam1 UTSW 3 116117228 missense possibly damaging 0.81
R7571:Vcam1 UTSW 3 116114383 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTCTAAACCTAAAATCCGGTG -3'
(R):5'- ACAGGCTGGAGATTGATCTGTTC -3'

Sequencing Primer
(F):5'- ACCTAAAATCCGGTGTCCTG -3'
(R):5'- GCTCATGAACAGACAGGA -3'
Posted On2016-10-26