Incidental Mutation 'R5597:Cnot6l'
ID 437869
Institutional Source Beutler Lab
Gene Symbol Cnot6l
Ensembl Gene ENSMUSG00000034724
Gene Name CCR4-NOT transcription complex, subunit 6-like
Synonyms
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock # R5597 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 96070333-96164171 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96131119 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 80 (D80G)
Ref Sequence ENSEMBL: ENSMUSP00000119415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036646] [ENSMUST00000113005] [ENSMUST00000122003] [ENSMUST00000129646] [ENSMUST00000137207] [ENSMUST00000141383] [ENSMUST00000154500] [ENSMUST00000155901]
AlphaFold Q8VEG6
Predicted Effect probably benign
Transcript: ENSMUST00000036646
Predicted Effect probably damaging
Transcript: ENSMUST00000113005
AA Change: D85G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108629
Gene: ENSMUSG00000034724
AA Change: D85G

DomainStartEndE-ValueType
LRR 55 77 4.34e-1 SMART
LRR 78 100 1.01e-1 SMART
LRR 101 124 7.55e-1 SMART
Pfam:Exo_endo_phos 192 529 7.3e-22 PFAM
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122003
AA Change: D80G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113821
Gene: ENSMUSG00000034724
AA Change: D80G

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Pfam:Exo_endo_phos 187 433 1.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129646
AA Change: D80G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123653
Gene: ENSMUSG00000034724
AA Change: D80G

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137066
Predicted Effect probably benign
Transcript: ENSMUST00000137207
AA Change: D80G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121627
Gene: ENSMUSG00000034724
AA Change: D80G

DomainStartEndE-ValueType
LRR_TYP 50 73 6.67e-2 SMART
Pfam:LRR_1 75 87 6.9e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141383
AA Change: D80G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114436
Gene: ENSMUSG00000034724
AA Change: D80G

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR_TYP 73 96 1.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154500
Predicted Effect probably damaging
Transcript: ENSMUST00000155901
AA Change: D80G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119415
Gene: ENSMUSG00000034724
AA Change: D80G

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Pfam:Exo_endo_phos 187 524 2.2e-23 PFAM
low complexity region 527 540 N/A INTRINSIC
Meta Mutation Damage Score 0.6592 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Cnot6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Cnot6l APN 5 96086246 missense probably damaging 1.00
IGL02102:Cnot6l APN 5 96091659 missense probably damaging 0.98
BB005:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
BB015:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
R0443:Cnot6l UTSW 5 96091745 splice site probably benign
R0448:Cnot6l UTSW 5 96080046 missense probably benign 0.00
R1436:Cnot6l UTSW 5 96134112 missense probably damaging 1.00
R2198:Cnot6l UTSW 5 96079941 missense possibly damaging 0.79
R4240:Cnot6l UTSW 5 96077362 missense probably benign
R4506:Cnot6l UTSW 5 96086174 missense possibly damaging 0.93
R4624:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4627:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4629:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4868:Cnot6l UTSW 5 96083023 missense probably damaging 1.00
R4936:Cnot6l UTSW 5 96079937 missense probably damaging 1.00
R5781:Cnot6l UTSW 5 96086165 missense probably benign 0.31
R6142:Cnot6l UTSW 5 96082978 missense probably benign 0.00
R6166:Cnot6l UTSW 5 96079940 missense possibly damaging 0.79
R6189:Cnot6l UTSW 5 96098277 missense probably benign 0.18
R6382:Cnot6l UTSW 5 96128999 missense probably damaging 0.99
R6515:Cnot6l UTSW 5 96161678 intron probably benign
R6773:Cnot6l UTSW 5 96094299 missense probably damaging 1.00
R7326:Cnot6l UTSW 5 96077299 missense probably benign 0.00
R7466:Cnot6l UTSW 5 96131128 missense probably benign 0.01
R7832:Cnot6l UTSW 5 96094225 missense possibly damaging 0.90
R7928:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
R8310:Cnot6l UTSW 5 96091676 missense probably benign
R8499:Cnot6l UTSW 5 96077317 missense probably damaging 1.00
R8698:Cnot6l UTSW 5 96077290 missense probably damaging 1.00
R9029:Cnot6l UTSW 5 96098277 missense probably benign 0.18
R9100:Cnot6l UTSW 5 96083016 missense probably damaging 1.00
R9377:Cnot6l UTSW 5 96128967 missense probably benign 0.01
R9485:Cnot6l UTSW 5 96082999 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATTAAATGGCGGCCAACTCATG -3'
(R):5'- CAGTACTTGGGATTCCGATTTTGTC -3'

Sequencing Primer
(F):5'- AACTCATGCACTGTGCTTAAC -3'
(R):5'- CGATTTTGTCGTGGATCTGGAG -3'
Posted On 2016-10-26