Incidental Mutation 'R5597:Hook2'
ID437879
Institutional Source Beutler Lab
Gene Symbol Hook2
Ensembl Gene ENSMUSG00000052566
Gene Namehook microtubule tethering protein 2
Synonyms
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5597 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84990603-85003349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84994028 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 166 (N166S)
Ref Sequence ENSEMBL: ENSMUSP00000148078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064495] [ENSMUST00000209764] [ENSMUST00000210326]
Predicted Effect probably benign
Transcript: ENSMUST00000064495
AA Change: N166S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067752
Gene: ENSMUSG00000052566
AA Change: N166S

DomainStartEndE-ValueType
Pfam:HOOK 8 703 2.3e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209652
Predicted Effect probably benign
Transcript: ENSMUST00000209764
AA Change: N166S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210326
AA Change: N166S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Hook2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Hook2 APN 8 85002497 unclassified probably benign
IGL01161:Hook2 APN 8 84994931 missense probably benign 0.05
IGL01535:Hook2 APN 8 85002989 missense probably benign 0.00
IGL01668:Hook2 APN 8 84993578 missense possibly damaging 0.88
IGL01749:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01750:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01753:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01900:Hook2 APN 8 85001311 unclassified probably benign
IGL02157:Hook2 APN 8 85001150 unclassified probably benign
IGL02175:Hook2 APN 8 84991402 missense probably damaging 1.00
IGL02350:Hook2 APN 8 84994985 nonsense probably null
IGL02357:Hook2 APN 8 84994985 nonsense probably null
IGL03377:Hook2 APN 8 85001335 nonsense probably null
R0399:Hook2 UTSW 8 84993567 splice site probably benign
R1133:Hook2 UTSW 8 84995804 missense probably damaging 1.00
R2087:Hook2 UTSW 8 85002691 missense probably damaging 0.98
R2277:Hook2 UTSW 8 85002931 nonsense probably null
R2398:Hook2 UTSW 8 84991299 missense probably damaging 0.98
R3406:Hook2 UTSW 8 84993984 splice site probably benign
R4752:Hook2 UTSW 8 85002720 nonsense probably null
R5014:Hook2 UTSW 8 84991377 missense probably damaging 1.00
R5068:Hook2 UTSW 8 84993399 missense possibly damaging 0.81
R5195:Hook2 UTSW 8 84994776 missense probably damaging 1.00
R5360:Hook2 UTSW 8 85001404 missense probably damaging 1.00
R5614:Hook2 UTSW 8 85002508 missense probably damaging 1.00
R5843:Hook2 UTSW 8 84991283 missense probably damaging 0.99
R5931:Hook2 UTSW 8 84995746 nonsense probably null
R5942:Hook2 UTSW 8 84994780 splice site probably null
R6120:Hook2 UTSW 8 84998125 missense probably damaging 1.00
R6167:Hook2 UTSW 8 84995013 missense probably damaging 1.00
R6936:Hook2 UTSW 8 85002998 missense probably benign 0.04
R6992:Hook2 UTSW 8 85002556 missense probably damaging 1.00
R7058:Hook2 UTSW 8 84997411 missense possibly damaging 0.89
R7101:Hook2 UTSW 8 84997051 missense probably benign
R7177:Hook2 UTSW 8 84991417 missense probably benign 0.07
R8072:Hook2 UTSW 8 84994491 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAGTCAGAATCCAGCAGCC -3'
(R):5'- TAATCTCAGCTACAAGCCAGG -3'

Sequencing Primer
(F):5'- CAGCCTCAAAAGTTGTGGTC -3'
(R):5'- CAGGCAGTCCCAGGAGAATC -3'
Posted On2016-10-26