Incidental Mutation 'R5597:Lars2'
ID437884
Institutional Source Beutler Lab
Gene Symbol Lars2
Ensembl Gene ENSMUSG00000035202
Gene Nameleucyl-tRNA synthetase, mitochondrial
SynonymsKiaa0028
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5597 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123366927-123462666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123454982 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 745 (D745V)
Ref Sequence ENSEMBL: ENSMUSP00000036710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000217116]
Predicted Effect probably damaging
Transcript: ENSMUST00000038863
AA Change: D745V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202
AA Change: D745V

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 57 223 7.6e-24 PFAM
Pfam:tRNA-synt_1g 83 239 9.3e-20 PFAM
Pfam:tRNA-synt_1_2 269 430 1.1e-8 PFAM
Pfam:tRNA-synt_1 434 609 5.6e-8 PFAM
Pfam:tRNA-synt_1g 589 682 1.2e-6 PFAM
Pfam:tRNA-synt_1 633 678 1.6e-7 PFAM
Pfam:Anticodon_1 724 867 9.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215087
Predicted Effect probably benign
Transcript: ENSMUST00000217116
Meta Mutation Damage Score 0.7171 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Lars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Lars2 APN 9 123453248 missense probably damaging 0.98
IGL01993:Lars2 APN 9 123394943 splice site probably benign
IGL02155:Lars2 APN 9 123454982 missense probably damaging 0.99
IGL02941:Lars2 APN 9 123459585 missense probably damaging 0.97
IGL03090:Lars2 APN 9 123455960 missense probably damaging 1.00
IGL03271:Lars2 APN 9 123459484 splice site probably null
IGL03386:Lars2 APN 9 123453390 nonsense probably null
IGL03410:Lars2 APN 9 123418776 missense possibly damaging 0.87
ulrich UTSW 9 123418693 missense probably damaging 0.99
K3955:Lars2 UTSW 9 123377777 missense probably damaging 1.00
P0038:Lars2 UTSW 9 123377777 missense probably damaging 1.00
R0276:Lars2 UTSW 9 123438121 splice site probably benign
R1671:Lars2 UTSW 9 123418279 missense probably benign 0.02
R1829:Lars2 UTSW 9 123431917 missense probably benign 0.00
R2219:Lars2 UTSW 9 123418780 missense probably damaging 0.98
R2220:Lars2 UTSW 9 123418780 missense probably damaging 0.98
R4610:Lars2 UTSW 9 123418693 missense probably damaging 0.99
R5027:Lars2 UTSW 9 123441495 missense probably benign 0.38
R5195:Lars2 UTSW 9 123453310 missense probably damaging 0.97
R5756:Lars2 UTSW 9 123438199 missense probably damaging 1.00
R5783:Lars2 UTSW 9 123461596 missense probably benign
R6045:Lars2 UTSW 9 123371988 missense probably damaging 1.00
R6235:Lars2 UTSW 9 123411880 missense probably damaging 1.00
R6323:Lars2 UTSW 9 123441594 nonsense probably null
R6377:Lars2 UTSW 9 123454760 missense probably benign 0.00
R6395:Lars2 UTSW 9 123371925 missense probably benign 0.06
R7094:Lars2 UTSW 9 123459585 missense probably damaging 0.99
R7144:Lars2 UTSW 9 123431993 missense probably damaging 1.00
R7233:Lars2 UTSW 9 123411954 nonsense probably null
R7254:Lars2 UTSW 9 123454963 missense possibly damaging 0.93
R7350:Lars2 UTSW 9 123427480 missense probably damaging 1.00
R7413:Lars2 UTSW 9 123459503 missense probably benign 0.30
R7614:Lars2 UTSW 9 123395111 missense
R7683:Lars2 UTSW 9 123377830 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCATCGAGGCAAGGACTTCC -3'
(R):5'- CTCTTACAAGAGGCCTGAAGC -3'

Sequencing Primer
(F):5'- AAGGACTTCCGGGACAGTC -3'
(R):5'- TCATTGTAAGTTGAAGGCCAGCC -3'
Posted On2016-10-26