Incidental Mutation 'R5597:Olfr807'
ID437885
Institutional Source Beutler Lab
Gene Symbol Olfr807
Ensembl Gene ENSMUSG00000050478
Gene Nameolfactory receptor 807
SynonymsMOR117-1, GA_x6K02T2PULF-11434134-11433199
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5597 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129754092-129757793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129754886 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 188 (D188G)
Ref Sequence ENSEMBL: ENSMUSP00000150657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059038] [ENSMUST00000213379] [ENSMUST00000217106]
Predicted Effect probably damaging
Transcript: ENSMUST00000059038
AA Change: D188G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049924
Gene: ENSMUSG00000050478
AA Change: D188G

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 3.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 302 3.4e-8 PFAM
Pfam:7tm_1 39 296 2.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213379
AA Change: D188G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217106
AA Change: D188G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Olfr807
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02586:Olfr807 APN 10 129754655 missense possibly damaging 0.87
IGL03031:Olfr807 APN 10 129755369 missense possibly damaging 0.94
R0691:Olfr807 UTSW 10 129755402 missense probably damaging 1.00
R0848:Olfr807 UTSW 10 129755208 missense probably benign 0.00
R0988:Olfr807 UTSW 10 129754997 missense probably benign 0.03
R1880:Olfr807 UTSW 10 129755421 missense probably benign 0.09
R1894:Olfr807 UTSW 10 129755074 nonsense probably null
R1935:Olfr807 UTSW 10 129754715 missense probably damaging 1.00
R2513:Olfr807 UTSW 10 129755152 missense probably damaging 1.00
R4201:Olfr807 UTSW 10 129754628 missense probably damaging 1.00
R4643:Olfr807 UTSW 10 129754955 missense probably damaging 1.00
R4651:Olfr807 UTSW 10 129755418 missense probably benign
R4652:Olfr807 UTSW 10 129755418 missense probably benign
R4797:Olfr807 UTSW 10 129754521 missense probably benign 0.06
R5337:Olfr807 UTSW 10 129754534 nonsense probably null
R6310:Olfr807 UTSW 10 129754659 missense probably benign 0.04
R6442:Olfr807 UTSW 10 129755408 missense probably damaging 1.00
R6443:Olfr807 UTSW 10 129755408 missense probably damaging 1.00
R6642:Olfr807 UTSW 10 129755363 missense probably damaging 1.00
R7660:Olfr807 UTSW 10 129754563 nonsense probably null
R7862:Olfr807 UTSW 10 129755355 missense probably benign 0.00
R7945:Olfr807 UTSW 10 129755355 missense probably benign 0.00
Z1088:Olfr807 UTSW 10 129755339 missense possibly damaging 0.77
Z1176:Olfr807 UTSW 10 129754688 missense not run
Z1176:Olfr807 UTSW 10 129754824 missense not run
Predicted Primers PCR Primer
(F):5'- AATGCAGCTGCCATAAGAGATG -3'
(R):5'- ACCGCTATGTGGCCATTTG -3'

Sequencing Primer
(F):5'- TGGAGACAACAATCATGTGTGAG -3'
(R):5'- ATGTGGCCATTTGTAGACCC -3'
Posted On2016-10-26