Incidental Mutation 'R5597:Dcaf5'
ID437890
Institutional Source Beutler Lab
Gene Symbol Dcaf5
Ensembl Gene ENSMUSG00000049106
Gene NameDDB1 and CUL4 associated factor 5
SynonymsWdr22, 9430020B07Rik, BCRG2, BCRP2
MMRRC Submission 043149-MU
Accession Numbers

Genbank: NM_177267; MGI: 2444785

Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R5597 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80335848-80436601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80340043 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 436 (S436R)
Ref Sequence ENSEMBL: ENSMUSP00000052755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054145]
Predicted Effect probably damaging
Transcript: ENSMUST00000054145
AA Change: S436R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052755
Gene: ENSMUSG00000049106
AA Change: S436R

DomainStartEndE-ValueType
WD40 42 82 3.32e-5 SMART
WD40 90 129 1.95e-2 SMART
WD40 132 171 1.28e-6 SMART
WD40 179 216 2.65e1 SMART
low complexity region 248 255 N/A INTRINSIC
WD40 264 308 1.66e0 SMART
WD40 322 361 2.01e-4 SMART
low complexity region 431 441 N/A INTRINSIC
low complexity region 506 518 N/A INTRINSIC
low complexity region 548 573 N/A INTRINSIC
low complexity region 623 638 N/A INTRINSIC
low complexity region 793 807 N/A INTRINSIC
low complexity region 929 941 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Dcaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Dcaf5 APN 12 80339323 missense probably benign 0.01
IGL00990:Dcaf5 APN 12 80338832 missense probably benign
IGL01788:Dcaf5 APN 12 80348324 missense probably damaging 1.00
IGL01865:Dcaf5 APN 12 80339314 missense probably benign 0.36
IGL02365:Dcaf5 APN 12 80398773 missense probably benign 0.01
R1160:Dcaf5 UTSW 12 80340215 missense possibly damaging 0.83
R1443:Dcaf5 UTSW 12 80364069 missense probably damaging 1.00
R1804:Dcaf5 UTSW 12 80339829 missense probably benign 0.19
R1945:Dcaf5 UTSW 12 80338694 missense probably benign 0.12
R2043:Dcaf5 UTSW 12 80340217 missense probably benign 0.03
R2104:Dcaf5 UTSW 12 80338861 missense probably benign 0.00
R4831:Dcaf5 UTSW 12 80339084 missense probably benign 0.00
R4860:Dcaf5 UTSW 12 80340232 missense probably benign 0.06
R4860:Dcaf5 UTSW 12 80340232 missense probably benign 0.06
R5257:Dcaf5 UTSW 12 80397719 missense probably damaging 1.00
R5263:Dcaf5 UTSW 12 80348346 missense probably damaging 1.00
R5569:Dcaf5 UTSW 12 80340201 missense probably damaging 1.00
R5632:Dcaf5 UTSW 12 80397752 missense probably damaging 0.98
R5779:Dcaf5 UTSW 12 80338832 missense probably benign
R5833:Dcaf5 UTSW 12 80348429 missense probably damaging 0.98
R6794:Dcaf5 UTSW 12 80398893 missense possibly damaging 0.66
R7188:Dcaf5 UTSW 12 80399958 missense probably damaging 1.00
R7238:Dcaf5 UTSW 12 80338709 missense probably benign 0.27
R7286:Dcaf5 UTSW 12 80348390 missense probably damaging 1.00
R7524:Dcaf5 UTSW 12 80376696 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTCACATGTTGGCGTTGCTG -3'
(R):5'- CCTGGATGGTCGGATTGAAG -3'

Sequencing Primer
(F):5'- GTTGACGCCACTGCATTTG -3'
(R):5'- ATTGAAGATGACTCCCGCTG -3'
Posted On2016-10-26