Incidental Mutation 'R5597:Anks3'
ID437893
Institutional Source Beutler Lab
Gene Symbol Anks3
Ensembl Gene ENSMUSG00000022515
Gene Nameankyrin repeat and sterile alpha motif domain containing 3
Synonyms2700067D09Rik
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5597 (G1)
Quality Score161
Status Validated
Chromosome16
Chromosomal Location4941436-4964205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4953929 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 77 (H77L)
Ref Sequence ENSEMBL: ENSMUSP00000155720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023157] [ENSMUST00000229017] [ENSMUST00000229765]
Predicted Effect probably benign
Transcript: ENSMUST00000023157
AA Change: H200L

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023157
Gene: ENSMUSG00000022515
AA Change: H200L

DomainStartEndE-ValueType
ANK 34 64 1.25e2 SMART
ANK 68 97 9.93e-5 SMART
ANK 101 130 9.13e-4 SMART
ANK 134 163 2.45e-4 SMART
ANK 168 197 9.27e-5 SMART
ANK 201 230 5.87e2 SMART
SAM 421 487 9.8e-12 SMART
coiled coil region 500 533 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000229017
AA Change: H77L

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000229765
AA Change: H200L

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230771
Meta Mutation Damage Score 0.0949 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Smad4 A C 18: 73,662,827 F165L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Anks3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Anks3 APN 16 4953929 missense possibly damaging 0.93
IGL01705:Anks3 APN 16 4947723 missense probably benign 0.00
IGL01953:Anks3 APN 16 4960544 missense probably damaging 1.00
IGL02378:Anks3 APN 16 4950762 missense possibly damaging 0.91
IGL03126:Anks3 APN 16 4958027 missense probably damaging 1.00
R0051:Anks3 UTSW 16 4947749 missense probably benign 0.16
R0051:Anks3 UTSW 16 4947749 missense probably benign 0.16
R0661:Anks3 UTSW 16 4948334 missense probably damaging 1.00
R0855:Anks3 UTSW 16 4955947 splice site probably benign
R0932:Anks3 UTSW 16 4953827 missense probably damaging 1.00
R1604:Anks3 UTSW 16 4948253 missense probably damaging 0.99
R1773:Anks3 UTSW 16 4947294 missense probably benign
R1846:Anks3 UTSW 16 4953884 missense probably benign 0.07
R1928:Anks3 UTSW 16 4946054 critical splice donor site probably null
R2323:Anks3 UTSW 16 4950770 critical splice acceptor site probably null
R3916:Anks3 UTSW 16 4947279 missense probably damaging 0.97
R5993:Anks3 UTSW 16 4958137 missense probably damaging 1.00
R7345:Anks3 UTSW 16 4955910 missense possibly damaging 0.88
R7373:Anks3 UTSW 16 4955871 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCTTACTGCTCAGGGCTG -3'
(R):5'- TACTCTTGGTGAGGCACTTG -3'

Sequencing Primer
(F):5'- GCTGCCTCAACTCCATCAGG -3'
(R):5'- CCTTTTCCCTGTTGTAAAGGAGACAG -3'
Posted On2016-10-26