Incidental Mutation 'R5597:Smad4'
ID437900
Institutional Source Beutler Lab
Gene Symbol Smad4
Ensembl Gene ENSMUSG00000024515
Gene NameSMAD family member 4
SynonymsDpc4, Smad 4, Madh4, DPC4, D18Wsu70e
MMRRC Submission 043149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5597 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location73639009-73703780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73662827 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 165 (F165L)
Ref Sequence ENSEMBL: ENSMUSP00000110589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025393] [ENSMUST00000114939]
Predicted Effect probably benign
Transcript: ENSMUST00000025393
AA Change: F165L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025393
Gene: ENSMUSG00000024515
AA Change: F165L

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114939
AA Change: F165L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110589
Gene: ENSMUSG00000024515
AA Change: F165L

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142672
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired formation of extraembryonic membrane and endoderm and die prior to gastrulation. Heterozygotes develop polyposis of the glandular stomach and duodenum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G A 11: 110,036,537 T1330I probably damaging Het
Aebp1 T C 11: 5,866,487 V322A probably benign Het
Anks3 T A 16: 4,953,929 H77L possibly damaging Het
Bsn A T 9: 108,114,932 M1207K probably benign Het
Btla A G 16: 45,244,236 T183A probably benign Het
Cdca8 G A 4: 124,919,000 R286W probably damaging Het
Cnot6l T C 5: 96,131,119 D80G probably damaging Het
Col16a1 A G 4: 130,058,304 D93G probably damaging Het
Ctsk T C 3: 95,501,696 V130A probably damaging Het
Cul9 T C 17: 46,502,665 E2294G possibly damaging Het
Dcaf5 G T 12: 80,340,043 S436R probably damaging Het
Dnah7a A T 1: 53,534,452 L1792H probably benign Het
Dst T C 1: 34,192,713 V3307A probably benign Het
Frrs1 C T 3: 116,878,238 probably benign Het
Gimap4 T C 6: 48,690,764 L151P probably damaging Het
Gm9268 A G 7: 43,024,649 D377G probably benign Het
Hook2 A G 8: 84,994,028 N166S probably benign Het
Hp1bp3 A T 4: 138,221,628 M1L possibly damaging Het
Igkv4-56 T A 6: 69,587,483 noncoding transcript Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Lamc1 A G 1: 153,251,970 C396R probably damaging Het
Lars2 A T 9: 123,454,982 D745V probably damaging Het
Macf1 A T 4: 123,539,777 probably benign Het
Mapk4 T A 18: 73,937,270 Y184F probably benign Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Msh2 T C 17: 87,723,361 S889P probably benign Het
Nebl A G 2: 17,378,167 S100P probably benign Het
Nudt7 A T 8: 114,151,766 H154L probably benign Het
Olfr1018 T C 2: 85,823,460 L163P probably damaging Het
Olfr192 A T 16: 59,098,347 V215D unknown Het
Olfr807 T C 10: 129,754,886 D188G probably damaging Het
Olig2 A T 16: 91,226,880 M161L probably benign Het
Palmd T A 3: 116,923,576 D424V probably damaging Het
Pdzk1ip1 A G 4: 115,093,492 N164D probably damaging Het
Prkag1 A G 15: 98,815,908 S14P probably damaging Het
Prss12 C T 3: 123,464,740 P161L probably benign Het
Pwwp2a T C 11: 43,682,595 V168A probably benign Het
Rassf7 A G 7: 141,217,111 D79G probably damaging Het
Rgs3 A T 4: 62,623,845 I19F probably damaging Het
Slc30a10 C A 1: 185,462,700 H236Q probably damaging Het
Slco3a1 C A 7: 74,284,462 R654L probably benign Het
Swsap1 G T 9: 21,955,946 R62M probably damaging Het
Tenm4 T A 7: 96,553,517 M113K probably benign Het
Tmem225 A G 9: 40,149,430 N95S possibly damaging Het
Tnni3k A T 3: 154,872,128 L658H probably damaging Het
Trem2 G A 17: 48,351,812 V202I probably benign Het
Tyw1 C T 5: 130,274,657 L289F probably benign Het
Vcam1 T A 3: 116,126,002 D205V probably damaging Het
Yy1 A G 12: 108,815,510 D367G probably damaging Het
Zfp11 A T 5: 129,657,102 C432S probably benign Het
Other mutations in Smad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Smad4 APN 18 73675809 missense probably damaging 1.00
IGL01647:Smad4 APN 18 73640473 splice site probably benign
IGL02055:Smad4 APN 18 73641928 splice site probably benign
IGL02101:Smad4 APN 18 73658652 missense probably benign 0.02
IGL02306:Smad4 APN 18 73662869 critical splice acceptor site probably null
R0391:Smad4 UTSW 18 73658649 missense probably benign
R1118:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1163:Smad4 UTSW 18 73648907 missense probably damaging 0.99
R1211:Smad4 UTSW 18 73649911 critical splice acceptor site probably null
R1616:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1742:Smad4 UTSW 18 73675897 missense probably damaging 1.00
R1829:Smad4 UTSW 18 73641894 missense probably benign 0.20
R2045:Smad4 UTSW 18 73649806 nonsense probably null
R2126:Smad4 UTSW 18 73662744 missense probably benign 0.02
R3013:Smad4 UTSW 18 73648904 missense probably damaging 1.00
R3973:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3974:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3975:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R4879:Smad4 UTSW 18 73641903 missense probably damaging 1.00
R5101:Smad4 UTSW 18 73675860 missense probably benign 0.41
R5984:Smad4 UTSW 18 73677911 start codon destroyed probably benign 0.29
R6450:Smad4 UTSW 18 73677746 missense possibly damaging 0.73
R7450:Smad4 UTSW 18 73677853 missense probably damaging 1.00
R7524:Smad4 UTSW 18 73675871 missense probably damaging 1.00
R8001:Smad4 UTSW 18 73641810 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCGACTCGATCTGACTGC -3'
(R):5'- GCTAGAGCTGATAAAATGCATGTC -3'

Sequencing Primer
(F):5'- GACTGCAACACTCACTTGTGG -3'
(R):5'- CCTTTCTGTGGAAATGGAA -3'
Posted On2016-10-26