Incidental Mutation 'R5598:Chrna1'
ID437905
Institutional Source Beutler Lab
Gene Symbol Chrna1
Ensembl Gene ENSMUSG00000027107
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)
SynonymsAcra, Achr-1
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5598 (G1)
Quality Score202
Status Not validated
Chromosome2
Chromosomal Location73563215-73580338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73566731 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 405 (T405S)
Ref Sequence ENSEMBL: ENSMUSP00000028515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028515]
PDB Structure
Crystal structure of the extracellular domain of the nicotinic acetylcholine receptor 1 subunit bound to alpha-bungarotoxin at 1.9 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028515
AA Change: T405S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000028515
Gene: ENSMUSG00000027107
AA Change: T405S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 231 1.5e-72 PFAM
Pfam:Neur_chan_memb 238 446 1.1e-67 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an alpha subunit of the muscle-derived nicotinic acetylcholine receptor, a pentameric neurotransmitter receptor and member of the ligand-gated ion channel superfamily. The alpha subunit plays a role in substrate binding and channel gating. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, kyphosis, carpotosis, absent miniature and nerve-evoked endplant potential, increased motor neuron number, and abnormal neuromuscular synapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Chrna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Chrna1 APN 2 73570642 missense probably benign
IGL02043:Chrna1 APN 2 73568106 missense probably benign 0.00
IGL02553:Chrna1 APN 2 73566862 missense possibly damaging 0.79
IGL02663:Chrna1 APN 2 73574316 splice site probably benign
IGL02799:Chrna1 APN 2 73574641 splice site probably benign
IGL03369:Chrna1 APN 2 73570445 missense probably benign 0.02
R0113:Chrna1 UTSW 2 73566836 missense possibly damaging 0.88
R0513:Chrna1 UTSW 2 73568082 splice site probably benign
R0540:Chrna1 UTSW 2 73571471 missense probably damaging 1.00
R0561:Chrna1 UTSW 2 73566252 missense possibly damaging 0.84
R1922:Chrna1 UTSW 2 73568232 missense probably damaging 1.00
R5303:Chrna1 UTSW 2 73566274 missense probably benign
R5481:Chrna1 UTSW 2 73566926 missense possibly damaging 0.90
R5931:Chrna1 UTSW 2 73568100 missense probably benign 0.39
R6153:Chrna1 UTSW 2 73573309 missense probably benign 0.02
R6194:Chrna1 UTSW 2 73570472 missense probably benign 0.17
R6301:Chrna1 UTSW 2 73570484 missense possibly damaging 0.92
R6455:Chrna1 UTSW 2 73566836 missense possibly damaging 0.88
X0026:Chrna1 UTSW 2 73570611 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GGTCAACCTCCCTGTCACAC -3'
(R):5'- TTTTATCGACACTATCCCAAACATC -3'

Sequencing Primer
(F):5'- AACCTCCCTGTCACACTTATG -3'
(R):5'- GTTTTTCTCCACAATGAAAAGACC -3'
Posted On2016-10-26