Incidental Mutation 'R5598:Ttll9'
ID437909
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Nametubulin tyrosine ligase-like family, member 9
Synonyms4930509O20Rik, 1700016F23Rik
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5598 (G1)
Quality Score203
Status Not validated
Chromosome2
Chromosomal Location152962485-153008482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152984314 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 148 (M148K)
Ref Sequence ENSEMBL: ENSMUSP00000105426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000155631] [ENSMUST00000165343]
Predicted Effect probably damaging
Transcript: ENSMUST00000099197
AA Change: M148K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673
AA Change: M148K

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103155
AA Change: M148K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673
AA Change: M148K

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109801
AA Change: M148K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673
AA Change: M148K

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect probably benign
Transcript: ENSMUST00000152158
Predicted Effect probably damaging
Transcript: ENSMUST00000155631
AA Change: M137K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114786
Gene: ENSMUSG00000074673
AA Change: M137K

DomainStartEndE-ValueType
Pfam:TTL 57 139 3.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165343
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152984260 missense probably damaging 0.99
IGL01107:Ttll9 APN 2 153002889 splice site probably benign
IGL01365:Ttll9 APN 2 153000134 missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152983105 missense probably damaging 0.99
IGL02264:Ttll9 APN 2 153000135 missense probably damaging 1.00
IGL02477:Ttll9 APN 2 153000197 missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 153002951 missense probably damaging 0.99
BB001:Ttll9 UTSW 2 152962487 unclassified probably benign
BB011:Ttll9 UTSW 2 152962487 unclassified probably benign
I2288:Ttll9 UTSW 2 152972339 splice site probably benign
R0053:Ttll9 UTSW 2 152962506 utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152983134 missense probably damaging 0.99
R0319:Ttll9 UTSW 2 153000098 splice site probably null
R0388:Ttll9 UTSW 2 153000179 missense probably benign
R0556:Ttll9 UTSW 2 152973606 critical splice donor site probably null
R0689:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R1829:Ttll9 UTSW 2 153000236 missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 153002294 missense probably damaging 1.00
R2144:Ttll9 UTSW 2 153003007 missense probably benign
R2229:Ttll9 UTSW 2 152983063 missense probably damaging 0.98
R2309:Ttll9 UTSW 2 152984145 missense probably damaging 1.00
R2314:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R4191:Ttll9 UTSW 2 153003007 missense probably benign
R4539:Ttll9 UTSW 2 152994091 missense probably damaging 1.00
R4866:Ttll9 UTSW 2 153003000 missense probably benign 0.02
R5115:Ttll9 UTSW 2 152989590 intron probably benign
R5279:Ttll9 UTSW 2 152962544 missense possibly damaging 0.80
R5342:Ttll9 UTSW 2 152991652 missense possibly damaging 0.87
R5375:Ttll9 UTSW 2 152984224 missense probably benign 0.13
R5417:Ttll9 UTSW 2 153002992 missense probably benign
R5555:Ttll9 UTSW 2 152990100 critical splice donor site probably null
R5574:Ttll9 UTSW 2 152984248 missense possibly damaging 0.90
R5613:Ttll9 UTSW 2 152973601 frame shift probably null
R6366:Ttll9 UTSW 2 152991605 missense probably damaging 0.99
R6409:Ttll9 UTSW 2 152999341 missense probably damaging 1.00
R6655:Ttll9 UTSW 2 153000303 splice site probably null
R6657:Ttll9 UTSW 2 152984262 missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152999300 nonsense probably null
R7012:Ttll9 UTSW 2 153003062 missense possibly damaging 0.46
R7162:Ttll9 UTSW 2 152989603 missense probably damaging 0.99
R7804:Ttll9 UTSW 2 153002358 critical splice donor site probably null
R7862:Ttll9 UTSW 2 153006975 missense probably benign 0.00
R7924:Ttll9 UTSW 2 152962487 unclassified probably benign
R7998:Ttll9 UTSW 2 152991626 missense possibly damaging 0.55
R8041:Ttll9 UTSW 2 153003036 missense possibly damaging 0.62
R8367:Ttll9 UTSW 2 152994148 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCTAAATAGAAGTGGGCAAGGC -3'
(R):5'- AGATGTCCAGTTGCAGACCC -3'

Sequencing Primer
(F):5'- TAGCTTACCAGGAAAAACTACATGG -3'
(R):5'- TCCAGTTGCAGACCCCTGAG -3'
Posted On2016-10-26