Incidental Mutation 'R5598:Nceh1'
ID437912
Institutional Source Beutler Lab
Gene Symbol Nceh1
Ensembl Gene ENSMUSG00000027698
Gene Nameneutral cholesterol ester hydrolase 1
SynonymsAadacl1, mKIAA1363, B230106I24Rik, CPO-BP
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5598 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location27182965-27284608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27226099 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 132 (T132A)
Ref Sequence ENSEMBL: ENSMUSP00000088829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046515] [ENSMUST00000091284] [ENSMUST00000138947]
Predicted Effect probably benign
Transcript: ENSMUST00000046515
AA Change: T132A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045864
Gene: ENSMUSG00000027698
AA Change: T132A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Abhydrolase_3 109 290 6.6e-36 PFAM
Pfam:Abhydrolase_3 294 382 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091284
AA Change: T132A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000088829
Gene: ENSMUSG00000027698
AA Change: T132A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Abhydrolase_3 109 152 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129412
Predicted Effect probably benign
Transcript: ENSMUST00000138947
SMART Domains Protein: ENSMUSP00000115209
Gene: ENSMUSG00000027698

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140872
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal organophosphorus metabolism and cholesterol homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Nceh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Nceh1 APN 3 27241313 missense probably damaging 1.00
IGL02113:Nceh1 APN 3 27222891 missense probably damaging 1.00
cerdo UTSW 3 27241271 nonsense probably null
BB006:Nceh1 UTSW 3 27279247 missense not run
BB016:Nceh1 UTSW 3 27279247 missense not run
R0281:Nceh1 UTSW 3 27222804 missense possibly damaging 0.64
R0854:Nceh1 UTSW 3 27241319 missense probably damaging 1.00
R1562:Nceh1 UTSW 3 27239552 missense probably damaging 1.00
R1689:Nceh1 UTSW 3 27226082 missense probably damaging 0.99
R1918:Nceh1 UTSW 3 27183175 missense probably damaging 1.00
R2851:Nceh1 UTSW 3 27241355 missense probably damaging 1.00
R3959:Nceh1 UTSW 3 27279196 missense probably benign 0.01
R4420:Nceh1 UTSW 3 27241649 missense probably damaging 1.00
R4686:Nceh1 UTSW 3 27241669 missense probably damaging 1.00
R5165:Nceh1 UTSW 3 27241528 missense probably benign
R5243:Nceh1 UTSW 3 27241688 missense probably damaging 1.00
R5255:Nceh1 UTSW 3 27183139 missense probably damaging 0.96
R6076:Nceh1 UTSW 3 27279195 missense probably benign 0.00
R6337:Nceh1 UTSW 3 27222807 missense probably damaging 0.96
R6729:Nceh1 UTSW 3 27241271 nonsense probably null
R6744:Nceh1 UTSW 3 27241789 missense probably damaging 1.00
R7618:Nceh1 UTSW 3 27183217 critical splice donor site probably null
R7749:Nceh1 UTSW 3 27207382 missense probably benign
R8040:Nceh1 UTSW 3 27241225 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACCCCTGATCCTTGTACC -3'
(R):5'- CACATCTGTAATTCCAACATTTGATGG -3'

Sequencing Primer
(F):5'- CTCCTGAGATCAGAAGCAAGGGC -3'
(R):5'- TTGGGCAGCTTACAAATACCTGC -3'
Posted On2016-10-26