Incidental Mutation 'R5598:Ubn2'
ID437918
Institutional Source Beutler Lab
Gene Symbol Ubn2
Ensembl Gene ENSMUSG00000038538
Gene Nameubinuclein 2
SynonymsD130059P03Rik, 6030408G03Rik, 2900060J04Rik
MMRRC Submission 043150-MU
Accession Numbers

Genbank: NM_177185; MGI: 2444236

Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R5598 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location38433950-38524825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38490388 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 677 (C677Y)
Ref Sequence ENSEMBL: ENSMUSP00000124043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039127] [ENSMUST00000160583] [ENSMUST00000162593]
Predicted Effect probably benign
Transcript: ENSMUST00000039127
AA Change: C679Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036188
Gene: ENSMUSG00000038538
AA Change: C679Y

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 180 231 4.8e-22 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 6.4e-80 PFAM
low complexity region 687 717 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
low complexity region 846 881 N/A INTRINSIC
low complexity region 1002 1042 N/A INTRINSIC
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1180 1199 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
low complexity region 1280 1297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159215
Predicted Effect probably benign
Transcript: ENSMUST00000159447
SMART Domains Protein: ENSMUSP00000123836
Gene: ENSMUSG00000038538

DomainStartEndE-ValueType
low complexity region 119 159 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159925
Predicted Effect probably benign
Transcript: ENSMUST00000160583
AA Change: C677Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124043
Gene: ENSMUSG00000038538
AA Change: C677Y

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 178 232 3.8e-23 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 2.9e-86 PFAM
low complexity region 685 715 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 844 879 N/A INTRINSIC
low complexity region 1000 1040 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1178 1197 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162423
Predicted Effect probably benign
Transcript: ENSMUST00000162593
AA Change: C526Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124352
Gene: ENSMUSG00000038538
AA Change: C526Y

DomainStartEndE-ValueType
Pfam:HUN 10 64 4.4e-24 PFAM
low complexity region 88 117 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 221 231 N/A INTRINSIC
Pfam:UBN_AB 266 482 3.1e-87 PFAM
low complexity region 534 564 N/A INTRINSIC
low complexity region 669 680 N/A INTRINSIC
low complexity region 693 728 N/A INTRINSIC
low complexity region 849 889 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
low complexity region 1027 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Ubn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Ubn2 APN 6 38482605 missense possibly damaging 0.91
IGL03116:Ubn2 APN 6 38491899 missense probably damaging 1.00
IGL03150:Ubn2 APN 6 38463714 missense probably benign
IGL03382:Ubn2 APN 6 38440447 unclassified probably benign
A4554:Ubn2 UTSW 6 38484110 missense probably damaging 1.00
R0008:Ubn2 UTSW 6 38434600 critical splice donor site probably null
R0034:Ubn2 UTSW 6 38491406 synonymous silent
R0121:Ubn2 UTSW 6 38452858 splice site probably benign
R0267:Ubn2 UTSW 6 38482618 critical splice donor site probably null
R1864:Ubn2 UTSW 6 38440490 missense possibly damaging 0.93
R1865:Ubn2 UTSW 6 38440490 missense possibly damaging 0.93
R1892:Ubn2 UTSW 6 38491291 missense probably damaging 1.00
R2174:Ubn2 UTSW 6 38470141 splice site probably null
R2184:Ubn2 UTSW 6 38484094 missense probably damaging 1.00
R2212:Ubn2 UTSW 6 38498739 missense probably benign 0.03
R2442:Ubn2 UTSW 6 38491005 missense probably benign 0.00
R3413:Ubn2 UTSW 6 38498739 missense probably benign 0.03
R4725:Ubn2 UTSW 6 38522305 utr 3 prime probably benign
R4765:Ubn2 UTSW 6 38479140 missense probably damaging 1.00
R4771:Ubn2 UTSW 6 38487153 splice site probably null
R4812:Ubn2 UTSW 6 38463726 missense probably benign
R4934:Ubn2 UTSW 6 38490498 missense probably benign 0.04
R5580:Ubn2 UTSW 6 38483252 missense probably damaging 0.99
R5672:Ubn2 UTSW 6 38461527 missense probably damaging 1.00
R5715:Ubn2 UTSW 6 38461477 nonsense probably null
R5817:Ubn2 UTSW 6 38479153 missense probably damaging 1.00
R5919:Ubn2 UTSW 6 38491488 missense possibly damaging 0.50
R5937:Ubn2 UTSW 6 38463982 missense possibly damaging 0.74
R6033:Ubn2 UTSW 6 38470224 critical splice donor site probably null
R6033:Ubn2 UTSW 6 38470224 critical splice donor site probably null
R6174:Ubn2 UTSW 6 38461536 missense probably damaging 1.00
R6338:Ubn2 UTSW 6 38490714 missense probably benign 0.00
R6653:Ubn2 UTSW 6 38434462 missense possibly damaging 0.72
R7282:Ubn2 UTSW 6 38452876 nonsense probably null
R7685:Ubn2 UTSW 6 38491792 missense probably benign 0.02
R7727:Ubn2 UTSW 6 38463938 missense probably benign 0.08
R7777:Ubn2 UTSW 6 38490753 missense probably damaging 1.00
R8074:Ubn2 UTSW 6 38440540 missense probably benign 0.13
R8218:Ubn2 UTSW 6 38489279 missense probably benign 0.01
R8283:Ubn2 UTSW 6 38498728 missense probably damaging 1.00
RF024:Ubn2 UTSW 6 38463628 missense probably damaging 1.00
X0010:Ubn2 UTSW 6 38483120 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGCTTTAAAATAAAGGGCCCAGTAC -3'
(R):5'- ATACAAGATCCAGTGAGGCTG -3'

Sequencing Primer
(F):5'- GAGTTCAAGGTCAGCCTAGTCTAC -3'
(R):5'- CTGAGGGGAAAGAAAGGTCTTCATC -3'
Posted On2016-10-26