Incidental Mutation 'R5598:Olfr591'
ID437920
Institutional Source Beutler Lab
Gene Symbol Olfr591
Ensembl Gene ENSMUSG00000057461
Gene Nameolfactory receptor 591
SynonymsMOR24-1P, GA_x6K02T2PBJ9-5889409-5888465
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5598 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103167074-103178340 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 103173634 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000150894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074272] [ENSMUST00000216581]
Predicted Effect probably null
Transcript: ENSMUST00000074272
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073884
Gene: ENSMUSG00000057461
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 9.4e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 255 7.1e-8 PFAM
Pfam:7tm_1 43 294 6.9e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216581
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218115
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Olfr591
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Olfr591 APN 7 103173451 missense probably damaging 1.00
IGL03307:Olfr591 APN 7 103173416 missense probably benign 0.00
R0082:Olfr591 UTSW 7 103173202 missense probably benign 0.05
R0389:Olfr591 UTSW 7 103173283 missense possibly damaging 0.48
R0843:Olfr591 UTSW 7 103173119 missense possibly damaging 0.74
R1378:Olfr591 UTSW 7 103173268 missense probably damaging 1.00
R1386:Olfr591 UTSW 7 103173367 missense probably benign 0.11
R1521:Olfr591 UTSW 7 103173451 missense probably benign 0.39
R1538:Olfr591 UTSW 7 103172986 missense probably damaging 0.97
R3108:Olfr591 UTSW 7 103173086 missense probably damaging 0.98
R3109:Olfr591 UTSW 7 103173086 missense probably damaging 0.98
R5350:Olfr591 UTSW 7 103173559 missense probably damaging 0.99
R5488:Olfr591 UTSW 7 103173451 missense probably damaging 1.00
R5489:Olfr591 UTSW 7 103173451 missense probably damaging 1.00
R5607:Olfr591 UTSW 7 103172849 missense probably damaging 0.96
R5608:Olfr591 UTSW 7 103172849 missense probably damaging 0.96
R6974:Olfr591 UTSW 7 103173235 missense probably damaging 0.99
R6994:Olfr591 UTSW 7 103172912 missense probably damaging 1.00
R7095:Olfr591 UTSW 7 103173046 missense probably benign 0.00
R8301:Olfr591 UTSW 7 103173073 missense probably damaging 0.99
Z1088:Olfr591 UTSW 7 103172806 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGGTACATTGGCTCATGGAGG -3'
(R):5'- CCTAAATCTGAGTTTAGGTGATGCTG -3'

Sequencing Primer
(F):5'- GCTCATGGAGGCTGGAGTC -3'
(R):5'- AGTTTAGGTGATGCTGTTTTAAAAAC -3'
Posted On2016-10-26