Incidental Mutation 'R5598:Drd2'
ID437925
Institutional Source Beutler Lab
Gene Symbol Drd2
Ensembl Gene ENSMUSG00000032259
Gene Namedopamine receptor D2
SynonymsDrd-2, D2 receptor, D2R
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R5598 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location49340627-49408177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49407015 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 419 (N419S)
Ref Sequence ENSEMBL: ENSMUSP00000075170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075764
AA Change: N419S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075170
Gene: ENSMUSG00000032259
AA Change: N419S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 45 238 2.5e-15 PFAM
Pfam:7tm_1 51 427 1.2e-88 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D2 subtype of the dopamine receptor. This G-protein coupled receptor inhibits adenylyl cyclase activity. A missense mutation in this gene causes myoclonus dystonia; other mutations have been associated with schizophrenia. Alternative splicing of this gene results in two transcript variants encoding different isoforms. A third variant has been described, but it has not been determined whether this form is normal or due to aberrant splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show Parkinson's disease like symptoms, including akinetic and bradykinetic behavior. Mice lacking only the long isoform are hypoactive and exhibit increased sterotypic behavior in response to dopamine agonists. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Drd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Drd2 APN 9 49395758 missense probably damaging 1.00
IGL01407:Drd2 APN 9 49400815 missense probably damaging 1.00
IGL01669:Drd2 APN 9 49402089 missense possibly damaging 0.90
IGL02011:Drd2 APN 9 49406958 missense probably damaging 1.00
IGL02417:Drd2 APN 9 49402259 splice site probably benign
R0374:Drd2 UTSW 9 49399784 missense probably benign 0.41
R0402:Drd2 UTSW 9 49404971 missense probably benign 0.00
R0529:Drd2 UTSW 9 49407074 missense probably benign
R1124:Drd2 UTSW 9 49395640 missense probably damaging 0.98
R1458:Drd2 UTSW 9 49402212 missense probably damaging 1.00
R1807:Drd2 UTSW 9 49405067 missense probably damaging 1.00
R1888:Drd2 UTSW 9 49402142 missense probably benign 0.05
R1888:Drd2 UTSW 9 49402142 missense probably benign 0.05
R1971:Drd2 UTSW 9 49407059 missense probably damaging 1.00
R2192:Drd2 UTSW 9 49403271 missense probably benign 0.03
R2218:Drd2 UTSW 9 49399794 missense probably damaging 1.00
R3830:Drd2 UTSW 9 49402143 missense probably damaging 0.99
R4214:Drd2 UTSW 9 49404921 missense probably benign 0.00
R4595:Drd2 UTSW 9 49404789 missense probably benign 0.03
R5392:Drd2 UTSW 9 49395628 missense possibly damaging 0.80
R5415:Drd2 UTSW 9 49402253 missense possibly damaging 0.81
R5646:Drd2 UTSW 9 49404912 missense probably benign
R5715:Drd2 UTSW 9 49404889 missense probably benign 0.00
R5901:Drd2 UTSW 9 49406959 nonsense probably null
R6365:Drd2 UTSW 9 49406949 missense probably damaging 1.00
R6748:Drd2 UTSW 9 49403202 nonsense probably null
R7017:Drd2 UTSW 9 49400829 missense probably benign 0.32
R7754:Drd2 UTSW 9 49404977 missense probably benign
X0022:Drd2 UTSW 9 49400781 missense probably damaging 1.00
Z1176:Drd2 UTSW 9 49395655 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTTAGCGGTCTTAGTGC -3'
(R):5'- TCAAGAGAAGGCCGAGTCCATC -3'

Sequencing Primer
(F):5'- TTAGCGGTCTTAGTGCCCCAAG -3'
(R):5'- GAGTCCATCTGGGCCTTTCTG -3'
Posted On2016-10-26