Incidental Mutation 'R5598:Cish'
ID437928
Institutional Source Beutler Lab
Gene Symbol Cish
Ensembl Gene ENSMUSG00000032578
Gene Namecytokine inducible SH2-containing protein
Synonymscytokine-inducible SH2 protein, CIS1, Cis, F23
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5598 (G1)
Quality Score210
Status Not validated
Chromosome9
Chromosomal Location107296026-107302784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107297028 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 5 (V5A)
Ref Sequence ENSEMBL: ENSMUSP00000082183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085102] [ENSMUST00000167072] [ENSMUST00000168260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085102
AA Change: V5A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082183
Gene: ENSMUSG00000032578
AA Change: V5A

DomainStartEndE-ValueType
SH2 80 169 8.36e-21 SMART
SOCS 213 254 1.49e-17 SMART
SOCS_box 219 253 9.58e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165664
Predicted Effect possibly damaging
Transcript: ENSMUST00000167072
AA Change: V5A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129941
Gene: ENSMUSG00000032578
AA Change: V5A

DomainStartEndE-ValueType
Pfam:SH2 49 103 4.8e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168260
AA Change: V5A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171568
SMART Domains Protein: ENSMUSP00000129149
Gene: ENSMUSG00000032578

DomainStartEndE-ValueType
Pfam:SH2 49 77 4.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a SH2 domain and a SOCS box domain. The protein thus belongs to the cytokine-induced STAT inhibitor (CIS), also known as suppressor of cytokine signaling (SOCS) or STAT-induced STAT inhibitor (SSI), protein family. CIS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by IL2, IL3, GM-CSF and EPO in hematopoietic cells. Proteasome-mediated degradation of this protein has been shown to be involved in the inactivation of the erythropoietin receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced Th2 and Th9 differentiation and allergic airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Cish
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1460:Cish UTSW 9 107300397 nonsense probably null
R5239:Cish UTSW 9 107299912 splice site probably null
R7706:Cish UTSW 9 107300641 missense probably benign 0.01
R8003:Cish UTSW 9 107297028 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGGTTCTAGGAAGATGAGGC -3'
(R):5'- CCGTTTCCCTATCCATACGAAG -3'

Sequencing Primer
(F):5'- TGAGGCTTCCGGGAAGG -3'
(R):5'- CATACGAAGTGTGTGTGGGTATCC -3'
Posted On2016-10-26